Human DBNL(Drebrin Like Protein) ELISA Kit
To Order Contact us: [email protected]
Human Drebrin Like Protein (DBNL) ELISA Kit |
SEL448Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 692.9 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Drebrin Like Protein (DBNL) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Drebrin Like Protein (DBNL) in Tissue homogenates, cell lysates and other biological fluids. |
Human Drebrin Like Protein (DBNL) ELISA Kit |
SEL448Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2818.05 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Drebrin Like Protein (DBNL) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Drebrin Like Protein (DBNL) in Tissue homogenates, cell lysates and other biological fluids. |
Human Drebrin Like Protein (DBNL) ELISA Kit |
4-SEL448Hu |
Cloud-Clone |
-
EUR 5240.00
-
EUR 2769.00
-
EUR 693.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Drebrin Like Protein elisa. Alternative names of the recognized antigen: ABP1
- HIP-55
- SH3P7
- CMAP
- Cervical mucin-associated protein
- Drebrin-F
- HPK1-interacting protein of 55 kDa
- SH3 domain-containing protein 7
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Drebrin Like Protein (DBNL) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Drebrin Like Protein (DBNL) Antibody |
20-abx112171 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Drebrin-Like Protein (DBNL) Antibody |
20-abx003516 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Drebrin-Like Protein (DBNL) Antibody |
abx029164-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Drebrin-Like Protein (DBNL) Antibody |
abx029164-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Drebrin-Like Protein (DBNL) Antibody |
abx232257-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Mouse Drebrin- like protein, Dbnl ELISA KIT |
ELI-26391m |
Lifescience Market |
96 Tests |
EUR 865 |
Bovine Drebrin- like protein, DBNL ELISA KIT |
ELI-09045b |
Lifescience Market |
96 Tests |
EUR 928 |
Mouse Drebrin Like Protein (DBNL) ELISA Kit |
abx389105-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Rat Drebrin Like Protein (DBNL) ELISA Kit |
abx391250-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Drebrin Like Protein (DBNL) CLIA Kit |
20-abx495928 |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
ELISA kit for Human DBNL (Drebrin Like Protein) |
ELK7533 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Drebrin Like Protein (DBNL). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Drebri
- Show more
|
Description: A sandwich ELISA kit for detection of Drebrin Like Protein from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Dbnl ELISA Kit| Rat Drebrin-like protein ELISA Kit |
EF018605 |
Lifescience Market |
96 Tests |
EUR 689 |
Dbnl ELISA Kit| Mouse Drebrin-like protein ELISA Kit |
EF014735 |
Lifescience Market |
96 Tests |
EUR 689 |
DBNL ELISA Kit| Bovine Drebrin-like protein ELISA Kit |
EF011332 |
Lifescience Market |
96 Tests |
EUR 689 |
Human Drebrin 1 (DBN1) ELISA Kit |
20-abx151349 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Drebrin 1 (DBN1) ELISA Kit |
DLR-DBN1-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Drebrin 1 (DBN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Drebrin 1 (DBN1) in samples from tissue homogenates or other biological fluids. |
Human Drebrin 1 (DBN1) ELISA Kit |
DLR-DBN1-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Drebrin 1 (DBN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Drebrin 1 (DBN1) in samples from tissue homogenates or other biological fluids. |
Human Drebrin 1 (DBN1) ELISA Kit |
SEC431Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Drebrin 1 (DBN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Drebrin 1 (DBN1) in Tissue homogenates and other biological fluids. |
Human Drebrin 1 (DBN1) ELISA Kit |
SEC431Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Drebrin 1 (DBN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Drebrin 1 (DBN1) in Tissue homogenates and other biological fluids. |
Human Drebrin 1 (DBN1) ELISA Kit |
SEC431Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Drebrin 1 (DBN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Drebrin 1 (DBN1) in Tissue homogenates and other biological fluids. |
Human Drebrin 1 (DBN1) ELISA Kit |
SEC431Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Drebrin 1 (DBN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Drebrin 1 (DBN1) in Tissue homogenates and other biological fluids. |
Human Drebrin 1 (DBN1) ELISA Kit |
4-SEC431Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Drebrin 1 elisa. Alternative names of the recognized antigen: Developmentally-regulated brain protein
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Drebrin 1 (DBN1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Human Drebrin 1 (DBN1) ELISA Kit |
RDR-DBN1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Drebrin 1 (DBN1) ELISA Kit |
RDR-DBN1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Drebrin 1 (DBN1) ELISA Kit |
RD-DBN1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Drebrin 1 (DBN1) ELISA Kit |
RD-DBN1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
DBNL Recombinant Protein (Human) |
RP008788 |
ABM |
100 ug |
Ask for price |
DBNL Recombinant Protein (Human) |
RP008791 |
ABM |
100 ug |
Ask for price |
ELISA kit for Human DBN1 (Drebrin 1) |
ELK3701 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Drebrin 1 (DBN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Drebrin 1 (DBN1).
- Show more
|
Description: A sandwich ELISA kit for detection of Drebrin 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Human Drebrin 1 (DBN1) Protein |
20-abx168078 |
Abbexa |
-
EUR 648.00
-
EUR 272.00
-
EUR 1943.00
-
EUR 759.00
-
EUR 467.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Drebrin Antibody |
abx139395-01mg |
Abbexa |
0.1 mg |
EUR 425 |
- Shipped within 5-12 working days.
|
Drebrin Antibody |
abx232535-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Drebrin Antibody |
abx232536-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
Drebrin antibody |
10R-D117a |
Fitzgerald |
100 ug |
EUR 570 |
Description: Mouse monoclonal Drebrin antibody |
Drebrin antibody |
10R-D117b |
Fitzgerald |
250 uL |
EUR 483 |
Description: Mouse monoclonal Drebrin antibody |
Drebrin antibody |
20R-DP003 |
Fitzgerald |
100 uL |
EUR 510 |
Description: Guinea Pig polyclonal Drebrin antibody |
Drebrin antibody |
20R-DP004 |
Fitzgerald |
100 uL |
EUR 510 |
Description: Guinea Pig polyclonal Drebrin antibody |
Drebrin antibody |
10R-2460 |
Fitzgerald |
5 mL |
EUR 405 |
Description: Mouse monoclonal Drebrin antibody |
Drebrin Antibody |
DF12388 |
Affbiotech |
200ul |
EUR 304 |
Description: Drebrin antibody detects endogenous levels of Drebrin. |
Mouse Drebrin 1 (DBN1) ELISA Kit |
abx576649-96tests |
Abbexa |
96 tests |
EUR 864 |
- Shipped within 5-12 working days.
|
Rat Drebrin 1 (DBN1) ELISA Kit |
abx576683-96tests |
Abbexa |
96 tests |
EUR 895 |
- Shipped within 5-12 working days.
|
Mouse Drebrin 1 (DBN1) ELISA Kit |
DLR-DBN1-Mu-48T |
DL Develop |
48T |
EUR 527 |
- Should the Mouse Drebrin 1 (DBN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Drebrin 1 (DBN1) in samples from tissue homogenates or other biological fluids. |
Mouse Drebrin 1 (DBN1) ELISA Kit |
DLR-DBN1-Mu-96T |
DL Develop |
96T |
EUR 688 |
- Should the Mouse Drebrin 1 (DBN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Drebrin 1 (DBN1) in samples from tissue homogenates or other biological fluids. |
Rat Drebrin 1 (DBN1) ELISA Kit |
DLR-DBN1-Ra-48T |
DL Develop |
48T |
EUR 549 |
- Should the Rat Drebrin 1 (DBN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Drebrin 1 (DBN1) in samples from tissue homogenates or other biological fluids. |
Rat Drebrin 1 (DBN1) ELISA Kit |
DLR-DBN1-Ra-96T |
DL Develop |
96T |
EUR 718 |
- Should the Rat Drebrin 1 (DBN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Drebrin 1 (DBN1) in samples from tissue homogenates or other biological fluids. |
Mouse Drebrin 1 (DBN1) ELISA Kit |
RDR-DBN1-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Mouse Drebrin 1 (DBN1) ELISA Kit |
RDR-DBN1-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 774 |
Rat Drebrin 1 (DBN1) ELISA Kit |
RDR-DBN1-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 583 |
Rat Drebrin 1 (DBN1) ELISA Kit |
RDR-DBN1-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 811 |
Mouse Drebrin 1 (DBN1) ELISA Kit |
RD-DBN1-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 533 |
Mouse Drebrin 1 (DBN1) ELISA Kit |
RD-DBN1-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 740 |
Rat Drebrin 1 (DBN1) ELISA Kit |
RD-DBN1-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Rat Drebrin 1 (DBN1) ELISA Kit |
RD-DBN1-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 775 |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
DBNL siRNA |
20-abx901418 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DBNL siRNA |
20-abx913607 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DBNL siRNA |
20-abx913608 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DBNL antibody |
70R-2474 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal DBNL antibody raised against the middle region of DBNL |
DBNL antibody |
70R-16749 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal DBNL antibody |
DBNL Antibody |
DF12594 |
Affbiotech |
200ul |
EUR 304 |
Description: DBNL Antibody detects endogenous levels of DBNL. |
DBNL Antibody |
1-CSB-PA006527GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against DBNL. Recognizes DBNL from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF |
Human Drebrin 1 (DBN1) CLIA Kit |
20-abx493691 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
DBNL Recombinant Protein (Rat) |
RP197375 |
ABM |
100 ug |
Ask for price |
DBNL Recombinant Protein (Mouse) |
RP127943 |
ABM |
100 ug |
Ask for price |
DBNL Recombinant Protein (Mouse) |
RP127946 |
ABM |
100 ug |
Ask for price |
DBNL Recombinant Protein (Mouse) |
RP127949 |
ABM |
100 ug |
Ask for price |
Human DBNL shRNA Plasmid |
20-abx959151 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
anti- Drebrin antibody |
FNab02535 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: drebrin 1
- Uniprot ID: Q16643
- Research Area: Neuroscience, Developmental biology
|
Description: Antibody raised against Drebrin |
anti- Drebrin antibody |
FNab02536 |
FN Test |
100µg |
EUR 585 |
- Immunogen: drebrin 1
- Uniprot ID: Q16643
- Research Area: Neuroscience, Developmental biology
|
Description: Antibody raised against Drebrin |
Drebrin Antibody (PE) |
abx139396-100tests |
Abbexa |
100 tests |
EUR 481 |
- Shipped within 5-12 working days.
|
Drebrin (DBN1) Antibody |
20-abx004866 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Anti-Drebrin Purified |
11-694-C025 |
ExBio |
0.025 mg |
EUR 122 |
Anti-Drebrin Purified |
11-694-C100 |
ExBio |
0.1 mg |
EUR 204 |
Anti-Drebrin PE |
1P-694-T025 |
ExBio |
25 tests |
EUR 140 |
Anti-Drebrin PE |
1P-694-T100 |
ExBio |
100 tests |
EUR 240 |
Drebrin Blocking Peptide |
DF12388-BP |
Affbiotech |
1mg |
EUR 195 |
Anti-Drebrin (2E11) |
YF-MA12638 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to Drebrin |
anti- DBNL antibody |
FNab02257 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: drebrin-like
- Uniprot ID: Q9UJU6
- Gene ID: 28988
- Research Area: Signal Transduction
|
Description: Antibody raised against DBNL |
DBNL Rabbit pAb |
A4663-100ul |
Abclonal |
100 ul |
EUR 308 |
DBNL Rabbit pAb |
A4663-200ul |
Abclonal |
200 ul |
EUR 459 |
DBNL Rabbit pAb |
A4663-20ul |
Abclonal |
20 ul |
Ask for price |
DBNL Rabbit pAb |
A4663-50ul |
Abclonal |
50 ul |
Ask for price |
DBNL Rabbit pAb |
A13751-100ul |
Abclonal |
100 ul |
EUR 308 |
DBNL Rabbit pAb |
A13751-200ul |
Abclonal |
200 ul |
EUR 459 |
DBNL Rabbit pAb |
A13751-20ul |
Abclonal |
20 ul |
EUR 183 |
DBNL Rabbit pAb |
A13751-50ul |
Abclonal |
50 ul |
EUR 223 |
DBNL Blocking Peptide |
33R-7539 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DBNL antibody, catalog no. 70R-2474 |
DBNL Polyclonal Antibody |
28333-100ul |
SAB |
100ul |
EUR 252 |
DBNL Polyclonal Antibody |
28333-50ul |
SAB |
50ul |
EUR 187 |
DBNL Blocking Peptide |
DF12594-BP |
Affbiotech |
1mg |
EUR 195 |
DBNL cloning plasmid |
CSB-CL892128HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1293
- Sequence: atggcggcgaacctgagccggaacgggccagcgctgcaagaggcctacgtgcgggtggtcaccgagaagtccccgaccgactgggctctctttacctatgaaggcaacagcaatgacatccgcgtggctggcacaggggagggtggcctggaggagatggtggaggagctcaaca
- Show more
|
Description: A cloning plasmid for the DBNL gene. |
DBNL cloning plasmid |
CSB-CL892128HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1296
- Sequence: atggcggcgaacctgagccggaacgggccagcgctgcaagaggcctacgtgcgggtggtcaccgagaagtccccgaccgactgggctctctttacctatgaaggcaacagcaatgacatccgcgtggctggcacaggggagggtggcctggaggagatggtggaggagctcaaca
- Show more
|
Description: A cloning plasmid for the DBNL gene. |
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit |
CAS400A-KIT |
SBI |
1 kit (10 rxn) |
EUR 1110 |
|
DBNL ORF Vector (Human) (pORF) |
ORF002930 |
ABM |
1.0 ug DNA |
EUR 95 |
DBNL ORF Vector (Human) (pORF) |
ORF002931 |
ABM |
1.0 ug DNA |
EUR 95 |
DBNL Protein Vector (Human) (pPB-C-His) |
PV011717 |
ABM |
500 ng |
EUR 329 |
DBNL Protein Vector (Human) (pPB-N-His) |
PV011718 |
ABM |
500 ng |
EUR 329 |
DBNL Protein Vector (Human) (pPM-C-HA) |
PV011719 |
ABM |
500 ng |
EUR 329 |
DBNL Protein Vector (Human) (pPM-C-His) |
PV011720 |
ABM |
500 ng |
EUR 329 |
DBNL Protein Vector (Human) (pPB-C-His) |
PV011721 |
ABM |
500 ng |
EUR 329 |
DBNL Protein Vector (Human) (pPB-N-His) |
PV011722 |
ABM |
500 ng |
EUR 329 |
DBNL Protein Vector (Human) (pPM-C-HA) |
PV011723 |
ABM |
500 ng |
EUR 329 |
DBNL Protein Vector (Human) (pPM-C-His) |
PV011724 |
ABM |
500 ng |
EUR 329 |
Drebrin 1 (DBN1) Antibody |
20-abx112170 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Drebrin 1 (DBN1) Antibody |
20-abx128413 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Drebrin 1 (DBN1) Antibody |
20-abx172162 |
Abbexa |
|
|
|
Drebrin recombinant monoclonal antibody |
A5309 |
Bimake |
100ul X 3 |
EUR 595 |
- Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
- Show more
|
Description: A recombinant monoclonal antibody from rabbit against human Drebrin for WB,ELISA |
Recombinant Drebrin 1 (DBN1) |
4-RPC431Hu01 |
Cloud-Clone |
-
EUR 458.40
-
EUR 226.00
-
EUR 1444.00
-
EUR 548.00
-
EUR 996.00
-
EUR 370.00
-
EUR 3460.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q16643
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 17.9kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Drebrin 1 expressed in: E.coli |
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
Column Packing Kit |
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
DBNL Polyclonal Conjugated Antibody |
C28333 |
SAB |
100ul |
EUR 397 |
Rat DBNL shRNA Plasmid |
20-abx986788 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse DBNL shRNA Plasmid |
20-abx969952 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
PCR Mycoplasma Detection Kit |
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
DBNL sgRNA CRISPR Lentivector set (Human) |
K0563501 |
ABM |
3 x 1.0 ug |
EUR 339 |
Anti-Drebrin Rabbit Monoclonal Antibody |
M05530 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal Drebrin Antibody. Validated in IF, WB and tested in Human, Mouse, Rat. |
Anti-Drebrin Monoclonal Antibody (M2F6) |
M05530-1 |
BosterBio |
100ug |
EUR 420 |
Description: Mouse Monoclonal Drebrin Antibody (M2F6). Validated in IP, IF, WB and tested in Mouse, Rat. |
Drebrin 1 (DBN1) Polyclonal Antibody (Human, Mouse) |
4-PAC431Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DBN1 (Gly3~Ser134 )
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Drebrin 1 (DBN1) |
CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV100PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV105PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV120PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV125PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
DBNL Protein Vector (Mouse) (pPB-C-His) |
PV170594 |
ABM |
500 ng |
EUR 603 |
DBNL Protein Vector (Mouse) (pPB-N-His) |
PV170595 |
ABM |
500 ng |
EUR 603 |
DBNL Protein Vector (Mouse) (pPM-C-HA) |
PV170596 |
ABM |
500 ng |
EUR 603 |
DBNL Protein Vector (Mouse) (pPM-C-His) |
PV170597 |
ABM |
500 ng |
EUR 603 |
DBNL Protein Vector (Mouse) (pPB-C-His) |
PV170598 |
ABM |
500 ng |
EUR 603 |
Human DBNL(Drebrin Like Protein) ELISA Kit