Human DBNL(Drebrin Like Protein) ELISA Kit

Human DBNL(Drebrin Like Protein) ELISA Kit

To Order Contact us: [email protected]

Human Drebrin Like Protein (DBNL) ELISA Kit
SEL448Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Drebrin Like Protein (DBNL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Drebrin Like Protein (DBNL) in Tissue homogenates, cell lysates and other biological fluids.
Human Drebrin Like Protein (DBNL) ELISA Kit
SEL448Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Drebrin Like Protein (DBNL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Drebrin Like Protein (DBNL) in Tissue homogenates, cell lysates and other biological fluids.
Human Drebrin Like Protein (DBNL) ELISA Kit
  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Drebrin Like Protein elisa. Alternative names of the recognized antigen: ABP1
  • HIP-55
  • SH3P7
  • CMAP
  • Cervical mucin-associated protein
  • Drebrin-F
  • HPK1-interacting protein of 55 kDa
  • SH3 domain-containing protein 7
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Drebrin Like Protein (DBNL) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.
Drebrin Like Protein (DBNL) Antibody
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Drebrin-Like Protein (DBNL) Antibody
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.
Drebrin-Like Protein (DBNL) Antibody
abx029164-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Drebrin-Like Protein (DBNL) Antibody
abx029164-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Drebrin-Like Protein (DBNL) Antibody
abx232257-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Mouse Drebrin- like protein, Dbnl ELISA KIT
ELI-26391m 96 Tests
EUR 865
Bovine Drebrin- like protein, DBNL ELISA KIT
ELI-09045b 96 Tests
EUR 928
Mouse Drebrin Like Protein (DBNL) ELISA Kit
abx389105-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Rat Drebrin Like Protein (DBNL) ELISA Kit
abx391250-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Drebrin Like Protein (DBNL) CLIA Kit
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
ELISA kit for Human DBNL (Drebrin Like Protein)
ELK7533 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Drebrin Like Protein (DBNL). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Drebri
  • Show more
Description: A sandwich ELISA kit for detection of Drebrin Like Protein from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Dbnl ELISA Kit| Rat Drebrin-like protein ELISA Kit
EF018605 96 Tests
EUR 689
Dbnl ELISA Kit| Mouse Drebrin-like protein ELISA Kit
EF014735 96 Tests
EUR 689
DBNL ELISA Kit| Bovine Drebrin-like protein ELISA Kit
EF011332 96 Tests
EUR 689
Dbnl/ Rat Dbnl ELISA Kit
ELI-07872r 96 Tests
EUR 886
EF009020 96 Tests
EUR 689
Human Drebrin, DBN1 ELISA KIT
ELI-09340h 96 Tests
EUR 824
Human Drebrin 1 (DBN1) ELISA Kit
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Drebrin 1 (DBN1) ELISA Kit
DLR-DBN1-Hu-48T 48T
EUR 517
  • Should the Human Drebrin 1 (DBN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Drebrin 1 (DBN1) in samples from tissue homogenates or other biological fluids.
Human Drebrin 1 (DBN1) ELISA Kit
DLR-DBN1-Hu-96T 96T
EUR 673
  • Should the Human Drebrin 1 (DBN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Drebrin 1 (DBN1) in samples from tissue homogenates or other biological fluids.
Human Drebrin 1 (DBN1) ELISA Kit
SEC431Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Drebrin 1 (DBN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Drebrin 1 (DBN1) in Tissue homogenates and other biological fluids.
Human Drebrin 1 (DBN1) ELISA Kit
SEC431Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Drebrin 1 (DBN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Drebrin 1 (DBN1) in Tissue homogenates and other biological fluids.
Human Drebrin 1 (DBN1) ELISA Kit
SEC431Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Drebrin 1 (DBN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Drebrin 1 (DBN1) in Tissue homogenates and other biological fluids.
Human Drebrin 1 (DBN1) ELISA Kit
SEC431Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Drebrin 1 (DBN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Drebrin 1 (DBN1) in Tissue homogenates and other biological fluids.
Human Drebrin 1 (DBN1) ELISA Kit
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Drebrin 1 elisa. Alternative names of the recognized antigen: Developmentally-regulated brain protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Drebrin 1 (DBN1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.
Human Drebrin 1 (DBN1) ELISA Kit
RDR-DBN1-Hu-48Tests 48 Tests
EUR 544
Human Drebrin 1 (DBN1) ELISA Kit
RDR-DBN1-Hu-96Tests 96 Tests
EUR 756
Human Drebrin 1 (DBN1) ELISA Kit
RD-DBN1-Hu-48Tests 48 Tests
EUR 521
Human Drebrin 1 (DBN1) ELISA Kit
RD-DBN1-Hu-96Tests 96 Tests
EUR 723
Human Drebrin 1(DBN1)ELISA Kit
QY-E01394 96T
EUR 361
DBNL Recombinant Protein (Human)
RP008788 100 ug Ask for price
DBNL Recombinant Protein (Human)
RP008791 100 ug Ask for price
Mouse Drebrin, Dbn1 ELISA KIT
ELI-08819m 96 Tests
EUR 865
Chicken Drebrin, DBN1 ELISA KIT
ELI-48161c 96 Tests
EUR 928
ELISA kit for Human DBN1 (Drebrin 1)
ELK3701 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Drebrin 1 (DBN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Drebrin 1 (DBN1).
  • Show more
Description: A sandwich ELISA kit for detection of Drebrin 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Human Drebrin 1 (DBN1) Protein
  • EUR 648.00
  • EUR 272.00
  • EUR 1943.00
  • EUR 759.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Dbn1 ELISA Kit| Rat Drebrin ELISA Kit
EF018604 96 Tests
EUR 689
Dbn1 ELISA Kit| Mouse Drebrin ELISA Kit
EF014734 96 Tests
EUR 689
DBN1 ELISA Kit| chicken Drebrin ELISA Kit
EF012286 96 Tests
EUR 689
Drebrin Antibody
abx139395-01mg 0.1 mg
EUR 425
  • Shipped within 5-12 working days.
Drebrin Antibody
abx232535-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Drebrin Antibody
abx232536-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.
Drebrin antibody
10R-D117a 100 ug
EUR 570
Description: Mouse monoclonal Drebrin antibody
Drebrin antibody
10R-D117b 250 uL
EUR 483
Description: Mouse monoclonal Drebrin antibody
Drebrin antibody
20R-DP003 100 uL
EUR 510
Description: Guinea Pig polyclonal Drebrin antibody
Drebrin antibody
20R-DP004 100 uL
EUR 510
Description: Guinea Pig polyclonal Drebrin antibody
Drebrin antibody
10R-2460 5 mL
EUR 405
Description: Mouse monoclonal Drebrin antibody
Drebrin Antibody
DF12388 200ul
EUR 304
Description: Drebrin antibody detects endogenous levels of Drebrin.
Mouse Drebrin 1 (DBN1) ELISA Kit
abx576649-96tests 96 tests
EUR 864
  • Shipped within 5-12 working days.
Rat Drebrin 1 (DBN1) ELISA Kit
abx576683-96tests 96 tests
EUR 895
  • Shipped within 5-12 working days.
Mouse Drebrin 1 (DBN1) ELISA Kit
DLR-DBN1-Mu-48T 48T
EUR 527
  • Should the Mouse Drebrin 1 (DBN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Drebrin 1 (DBN1) in samples from tissue homogenates or other biological fluids.
Mouse Drebrin 1 (DBN1) ELISA Kit
DLR-DBN1-Mu-96T 96T
EUR 688
  • Should the Mouse Drebrin 1 (DBN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Drebrin 1 (DBN1) in samples from tissue homogenates or other biological fluids.
Rat Drebrin 1 (DBN1) ELISA Kit
DLR-DBN1-Ra-48T 48T
EUR 549
  • Should the Rat Drebrin 1 (DBN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Drebrin 1 (DBN1) in samples from tissue homogenates or other biological fluids.
Rat Drebrin 1 (DBN1) ELISA Kit
DLR-DBN1-Ra-96T 96T
EUR 718
  • Should the Rat Drebrin 1 (DBN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Drebrin 1 (DBN1) in samples from tissue homogenates or other biological fluids.
Mouse Drebrin 1 (DBN1) ELISA Kit
RDR-DBN1-Mu-48Tests 48 Tests
EUR 557
Mouse Drebrin 1 (DBN1) ELISA Kit
RDR-DBN1-Mu-96Tests 96 Tests
EUR 774
Rat Drebrin 1 (DBN1) ELISA Kit
RDR-DBN1-Ra-48Tests 48 Tests
EUR 583
Rat Drebrin 1 (DBN1) ELISA Kit
RDR-DBN1-Ra-96Tests 96 Tests
EUR 811
Mouse Drebrin 1 (DBN1) ELISA Kit
RD-DBN1-Mu-48Tests 48 Tests
EUR 533
Mouse Drebrin 1 (DBN1) ELISA Kit
RD-DBN1-Mu-96Tests 96 Tests
EUR 740
Rat Drebrin 1 (DBN1) ELISA Kit
RD-DBN1-Ra-48Tests 48 Tests
EUR 557
Rat Drebrin 1 (DBN1) ELISA Kit
RD-DBN1-Ra-96Tests 96 Tests
EUR 775
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
EUR 202
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
DBNL antibody
70R-2474 50 ug
EUR 467
Description: Rabbit polyclonal DBNL antibody raised against the middle region of DBNL
DBNL antibody
70R-16749 50 ul
EUR 435
Description: Rabbit polyclonal DBNL antibody
DBNL Antibody
DF12594 200ul
EUR 304
Description: DBNL Antibody detects endogenous levels of DBNL.
DBNL Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against DBNL. Recognizes DBNL from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF
Human Drebrin 1 (DBN1) CLIA Kit
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
DBNL Recombinant Protein (Rat)
RP197375 100 ug Ask for price
DBNL Recombinant Protein (Mouse)
RP127943 100 ug Ask for price
DBNL Recombinant Protein (Mouse)
RP127946 100 ug Ask for price
DBNL Recombinant Protein (Mouse)
RP127949 100 ug Ask for price
Human DBNL shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
anti- Drebrin antibody
FNab02535 100µg
EUR 505.25
  • Immunogen: drebrin 1
  • Uniprot ID: Q16643
  • Research Area: Neuroscience, Developmental biology
Description: Antibody raised against Drebrin
anti- Drebrin antibody
FNab02536 100µg
EUR 585
  • Immunogen: drebrin 1
  • Uniprot ID: Q16643
  • Research Area: Neuroscience, Developmental biology
Description: Antibody raised against Drebrin
Drebrin Antibody (PE)
abx139396-100tests 100 tests
EUR 481
  • Shipped within 5-12 working days.
Drebrin (DBN1) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Anti-Drebrin Purified
11-694-C025 0.025 mg
EUR 122
Anti-Drebrin Purified
11-694-C100 0.1 mg
EUR 204
Anti-Drebrin PE
1P-694-T025 25 tests
EUR 140
Anti-Drebrin PE
1P-694-T100 100 tests
EUR 240
Drebrin Blocking Peptide
DF12388-BP 1mg
EUR 195
Anti-Drebrin antibody
PAab02535 100 ug
EUR 355
Anti-Drebrin antibody
PAab02536 100 ug
EUR 412
Anti-Drebrin (2E11)
YF-MA12638 100 ug
EUR 363
Description: Mouse monoclonal to Drebrin
anti- DBNL antibody
FNab02257 100µg
EUR 505.25
  • Immunogen: drebrin-like
  • Uniprot ID: Q9UJU6
  • Gene ID: 28988
  • Research Area: Signal Transduction
Description: Antibody raised against DBNL
DBNL Rabbit pAb
A4663-100ul 100 ul
EUR 308
DBNL Rabbit pAb
A4663-200ul 200 ul
EUR 459
DBNL Rabbit pAb
A4663-20ul 20 ul Ask for price
DBNL Rabbit pAb
A4663-50ul 50 ul Ask for price
DBNL Rabbit pAb
A13751-100ul 100 ul
EUR 308
DBNL Rabbit pAb
A13751-200ul 200 ul
EUR 459
DBNL Rabbit pAb
A13751-20ul 20 ul
EUR 183
DBNL Rabbit pAb
A13751-50ul 50 ul
EUR 223
DBNL Blocking Peptide
33R-7539 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DBNL antibody, catalog no. 70R-2474
DBNL Polyclonal Antibody
28333-100ul 100ul
EUR 252
DBNL Polyclonal Antibody
28333-50ul 50ul
EUR 187
DBNL Blocking Peptide
DF12594-BP 1mg
EUR 195
DBNL cloning plasmid
CSB-CL892128HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1293
  • Sequence: atggcggcgaacctgagccggaacgggccagcgctgcaagaggcctacgtgcgggtggtcaccgagaagtccccgaccgactgggctctctttacctatgaaggcaacagcaatgacatccgcgtggctggcacaggggagggtggcctggaggagatggtggaggagctcaaca
  • Show more
Description: A cloning plasmid for the DBNL gene.
DBNL cloning plasmid
CSB-CL892128HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1296
  • Sequence: atggcggcgaacctgagccggaacgggccagcgctgcaagaggcctacgtgcgggtggtcaccgagaagtccccgaccgactgggctctctttacctatgaaggcaacagcaatgacatccgcgtggctggcacaggggagggtggcctggaggagatggtggaggagctcaaca
  • Show more
Description: A cloning plasmid for the DBNL gene.
Anti-DBNL antibody
PAab02257 100 ug
EUR 355
Anti-DBNL antibody
STJ23342 100 µl
EUR 277
Anti-DBNL antibody
STJ115699 100 µl
EUR 277
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9
DBNL ORF Vector (Human) (pORF)
ORF002930 1.0 ug DNA
EUR 95
DBNL ORF Vector (Human) (pORF)
ORF002931 1.0 ug DNA
EUR 95
DBNL Protein Vector (Human) (pPB-C-His)
PV011717 500 ng
EUR 329
DBNL Protein Vector (Human) (pPB-N-His)
PV011718 500 ng
EUR 329
DBNL Protein Vector (Human) (pPM-C-HA)
PV011719 500 ng
EUR 329
DBNL Protein Vector (Human) (pPM-C-His)
PV011720 500 ng
EUR 329
DBNL Protein Vector (Human) (pPB-C-His)
PV011721 500 ng
EUR 329
DBNL Protein Vector (Human) (pPB-N-His)
PV011722 500 ng
EUR 329
DBNL Protein Vector (Human) (pPM-C-HA)
PV011723 500 ng
EUR 329
DBNL Protein Vector (Human) (pPM-C-His)
PV011724 500 ng
EUR 329
Drebrin 1 (DBN1) Antibody
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Drebrin 1 (DBN1) Antibody
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Drebrin 1 (DBN1) Antibody
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Drebrin recombinant monoclonal antibody
A5309 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human Drebrin for WB,ELISA
Recombinant Drebrin 1 (DBN1)
  • EUR 458.40
  • EUR 226.00
  • EUR 1444.00
  • EUR 548.00
  • EUR 996.00
  • EUR 370.00
  • EUR 3460.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q16643
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 17.9kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Drebrin 1 expressed in: E.coli
Frit Kit
FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.
Column Packing Kit
PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.
DBNL Polyclonal Conjugated Antibody
C28333 100ul
EUR 397
Rat DBNL shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse DBNL shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
PCR Mycoplasma Detection Kit
M034-Kit Kit
EUR 266
DBNL sgRNA CRISPR Lentivector set (Human)
K0563501 3 x 1.0 ug
EUR 339
Anti-Drebrin Rabbit Monoclonal Antibody
M05530 100ug/vial
EUR 397
Description: Rabbit Monoclonal Drebrin Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.
Anti-Drebrin Monoclonal Antibody (M2F6)
M05530-1 100ug
EUR 420
Description: Mouse Monoclonal Drebrin Antibody (M2F6). Validated in IP, IF, WB and tested in Mouse, Rat.
Drebrin 1 (DBN1) Polyclonal Antibody (Human, Mouse)
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DBN1 (Gly3~Ser134 )
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Drebrin 1 (DBN1)
CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
EUR 1132
  • Category: Cas9
CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
EUR 1132
  • Category: Cas9
MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
EUR 1132
  • Category: Cas9
MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
EUR 1132
  • Category: Cas9
DBNL Protein Vector (Mouse) (pPB-C-His)
PV170594 500 ng
EUR 603
DBNL Protein Vector (Mouse) (pPB-N-His)
PV170595 500 ng
EUR 603
DBNL Protein Vector (Mouse) (pPM-C-HA)
PV170596 500 ng
EUR 603
DBNL Protein Vector (Mouse) (pPM-C-His)
PV170597 500 ng
EUR 603
DBNL Protein Vector (Mouse) (pPB-C-His)
PV170598 500 ng
EUR 603

Human DBNL(Drebrin Like Protein) ELISA Kit