Human TMEM173(Transmembrane Protein 173) ELISA Kit

Human TMEM173(Transmembrane Protein 173) ELISA Kit

To Order Contact us: [email protected]

Human Transmembrane Protein 173 (TMEM173) ELISA Kit
20-abx258669	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Transmembrane Protein 173 (TMEM173) ELISA Kit
SEN011Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5189.65
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transmembrane Protein 173 (TMEM173) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transmembrane Protein 173 (TMEM173) in Tissue homogenates, cell lysates and other biological fluids.

Human Transmembrane Protein 173 (TMEM173) ELISA Kit
SEN011Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 515.03
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transmembrane Protein 173 (TMEM173) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transmembrane Protein 173 (TMEM173) in Tissue homogenates, cell lysates and other biological fluids.

Human Transmembrane Protein 173 (TMEM173) ELISA Kit
SEN011Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 692.9
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transmembrane Protein 173 (TMEM173) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transmembrane Protein 173 (TMEM173) in Tissue homogenates, cell lysates and other biological fluids.

Human Transmembrane Protein 173 (TMEM173) ELISA Kit
SEN011Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2818.05
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transmembrane Protein 173 (TMEM173) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transmembrane Protein 173 (TMEM173) in Tissue homogenates, cell lysates and other biological fluids.

Human Transmembrane Protein 173 (TMEM173) ELISA Kit
4-SEN011Hu	Cloud-Clone	EUR 5240.00 EUR 2769.00 EUR 693.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Transmembrane Protein 173 elisa. Alternative names of the recognized antigen: NET23 ERIS MPYS MITA STING Endoplasmic Reticulum Interferon Stimulator Stimulator Of Interferon Genes Protein Mediator of IRF3 activation
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Transmembrane Protein 173 (TMEM173) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Transmembrane Protein 173 (TMEM173) Protein
20-abx069447	Abbexa	EUR 648.00 EUR 272.00 EUR 1943.00 EUR 759.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Transmembrane Protein 173 (TMEM173) Antibody
20-abx116240	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Transmembrane Protein 173 (TMEM173) Antibody
20-abx129806	Abbexa	EUR 467.00 EUR 133.00 EUR 1344.00 EUR 634.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Transmembrane Protein 173 (TMEM173) Antibody
20-abx102945	Abbexa	EUR 453.00 EUR 133.00 EUR 1302.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Transmembrane Protein 173 (TMEM173) Antibody
20-abx102946	Abbexa	EUR 481.00 EUR 133.00 EUR 1414.00 EUR 662.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Transmembrane Protein 173 (TMEM173) Antibody
20-abx325479	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Recombinant Transmembrane Protein 173 (TMEM173)
4-RPN011Hu01	Cloud-Clone	EUR 458.40 EUR 226.00 EUR 1444.00 EUR 548.00 EUR 996.00 EUR 370.00 EUR 3460.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q86WV6 Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 28.2kDa Isoelectric Point: 5.8
Description: Recombinant Human Transmembrane Protein 173 expressed in: E.coli

Recombinant Transmembrane Protein 173 (TMEM173)
4-RPN011Mu01	Cloud-Clone	EUR 485.28 EUR 233.00 EUR 1544.80 EUR 581.60 EUR 1063.20 EUR 388.00 EUR 3712.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q3TBT3 Buffer composition: 100mMNaHCO3, 500mMNaCl, pH8.3, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 27.8kDa Isoelectric Point: 5.2
Description: Recombinant Mouse Transmembrane Protein 173 expressed in: E.coli

Recombinant Transmembrane Protein 173 (TMEM173)
4-RPN011Ra01	Cloud-Clone	EUR 494.24 EUR 235.00 EUR 1578.40 EUR 592.80 EUR 1085.60 EUR 394.00 EUR 3796.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: F1M391 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 26.9kDa Isoelectric Point: Inquire
Description: Recombinant Rat Transmembrane Protein 173 expressed in: E.coli

Mouse Transmembrane protein 173(TMEM173) ELISA kit
E03T0704-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Transmembrane protein 173(TMEM173) ELISA kit
E03T0704-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Transmembrane protein 173(TMEM173) ELISA kit
E03T0704-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Transmembrane protein 173(TMEM173) ELISA kit
E02T0704-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Transmembrane protein 173(TMEM173) ELISA kit
E02T0704-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Transmembrane protein 173(TMEM173) ELISA kit
E02T0704-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Transmembrane protein 173(TMEM173) ELISA kit
E04T0704-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Transmembrane protein 173(TMEM173) ELISA kit
E04T0704-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Transmembrane protein 173(TMEM173) ELISA kit
E04T0704-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Transmembrane protein 173(TMEM173) ELISA kit
E08T0704-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Transmembrane protein 173(TMEM173) ELISA kit
E08T0704-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Transmembrane protein 173(TMEM173) ELISA kit
E08T0704-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Transmembrane protein 173(TMEM173) ELISA kit
E07T0704-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Transmembrane protein 173(TMEM173) ELISA kit
E07T0704-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Transmembrane protein 173(TMEM173) ELISA kit
E07T0704-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Transmembrane protein 173(TMEM173) ELISA kit
E06T0704-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Transmembrane protein 173(TMEM173) ELISA kit
E06T0704-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Transmembrane protein 173(TMEM173) ELISA kit
E06T0704-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Transmembrane protein 173(TMEM173) ELISA kit
E09T0704-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Transmembrane protein 173(TMEM173) ELISA kit
E09T0704-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Transmembrane protein 173(TMEM173) ELISA kit
E09T0704-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Chicken Transmembrane protein 173, TMEM173 ELISA KIT
ELI-17107c	Lifescience Market	96 Tests	EUR 928

Mouse Transmembrane protein 173, Tmem173 ELISA KIT
ELI-37526m	Lifescience Market	96 Tests	EUR 865

Porcine Transmembrane protein 173, TMEM173 ELISA KIT
ELI-39868p	Lifescience Market	96 Tests	EUR 928

Bovine Transmembrane protein 173, TMEM173 ELISA KIT
ELI-41973b	Lifescience Market	96 Tests	EUR 928

Human Transmembrane Protein 173 (TMEM173) CLIA Kit
20-abx496082	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human TMEM173 (Transmembrane Protein 173)
ELK7591	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Transmembrane Protein 173 (TMEM173). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific t Show more
Description: A sandwich ELISA kit for detection of Transmembrane Protein 173 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Transmembrane protein 173 (TMEM173)
KTE60282-48T	Abbkine	48T	EUR 332
The deduced 379-amino acid protein has a calculated molecular mass of 42.2 kD. It has 5 putative N-terminal transmembrane domains, a signal cleavage site in the first transmembrane domain, and a leucine-rich region that overlaps the first 4 transmemb Show more
Description: Quantitative sandwich ELISA for measuring Human Transmembrane protein 173 (TMEM173) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Transmembrane protein 173 (TMEM173)
KTE60282-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
The deduced 379-amino acid protein has a calculated molecular mass of 42.2 kD. It has 5 putative N-terminal transmembrane domains, a signal cleavage site in the first transmembrane domain, and a leucine-rich region that overlaps the first 4 transmemb Show more
Description: Quantitative sandwich ELISA for measuring Human Transmembrane protein 173 (TMEM173) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Transmembrane protein 173 (TMEM173)
KTE60282-96T	Abbkine	96T	EUR 539
The deduced 379-amino acid protein has a calculated molecular mass of 42.2 kD. It has 5 putative N-terminal transmembrane domains, a signal cleavage site in the first transmembrane domain, and a leucine-rich region that overlaps the first 4 transmemb Show more
Description: Quantitative sandwich ELISA for measuring Human Transmembrane protein 173 (TMEM173) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Rat Transmembrane Protein 173 (TMEM173) Protein
20-abx069448	Abbexa	EUR 690.00 EUR 286.00 EUR 2124.00 EUR 815.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Mouse Transmembrane Protein 173 (TMEM173) Protein
20-abx165931	Abbexa	EUR 676.00 EUR 286.00 EUR 2082.00 EUR 801.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Transmembrane Protein 173 (TMEM173) Antibody (FITC)
20-abx274261	Abbexa	EUR 509.00 EUR 258.00 EUR 1539.00 EUR 718.00 EUR 411.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Guinea pig Transmembrane protein 173(TMEM173) ELISA kit
E05T0704-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Transmembrane protein 173(TMEM173) ELISA kit
E05T0704-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Transmembrane protein 173(TMEM173) ELISA kit
E05T0704-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Pig Transmembrane protein 173 (TMEM173)
KTE80020-48T	Abbkine	48T	EUR 354
The deduced 379-amino acid protein has a calculated molecular mass of 42.2 kD. It has 5 putative N-terminal transmembrane domains, a signal cleavage site in the first transmembrane domain, and a leucine-rich region that overlaps the first 4 transmemb Show more
Description: Quantitative sandwich ELISA for measuring Pig Transmembrane protein 173 (TMEM173) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Pig Transmembrane protein 173 (TMEM173)
KTE80020-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
The deduced 379-amino acid protein has a calculated molecular mass of 42.2 kD. It has 5 putative N-terminal transmembrane domains, a signal cleavage site in the first transmembrane domain, and a leucine-rich region that overlaps the first 4 transmemb Show more
Description: Quantitative sandwich ELISA for measuring Pig Transmembrane protein 173 (TMEM173) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Pig Transmembrane protein 173 (TMEM173)
KTE80020-96T	Abbkine	96T	EUR 572
The deduced 379-amino acid protein has a calculated molecular mass of 42.2 kD. It has 5 putative N-terminal transmembrane domains, a signal cleavage site in the first transmembrane domain, and a leucine-rich region that overlaps the first 4 transmemb Show more
Description: Quantitative sandwich ELISA for measuring Pig Transmembrane protein 173 (TMEM173) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Transmembrane protein 173 (TMEM173)
KTE10047-48T	Abbkine	48T	EUR 354
The deduced 379-amino acid protein has a calculated molecular mass of 42.2 kD. It has 5 putative N-terminal transmembrane domains, a signal cleavage site in the first transmembrane domain, and a leucine-rich region that overlaps the first 4 transmemb Show more
Description: Quantitative sandwich ELISA for measuring Bovine Transmembrane protein 173 (TMEM173) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Transmembrane protein 173 (TMEM173)
KTE10047-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
The deduced 379-amino acid protein has a calculated molecular mass of 42.2 kD. It has 5 putative N-terminal transmembrane domains, a signal cleavage site in the first transmembrane domain, and a leucine-rich region that overlaps the first 4 transmemb Show more
Description: Quantitative sandwich ELISA for measuring Bovine Transmembrane protein 173 (TMEM173) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Transmembrane protein 173 (TMEM173)
KTE10047-96T	Abbkine	96T	EUR 572
The deduced 379-amino acid protein has a calculated molecular mass of 42.2 kD. It has 5 putative N-terminal transmembrane domains, a signal cleavage site in the first transmembrane domain, and a leucine-rich region that overlaps the first 4 transmemb Show more
Description: Quantitative sandwich ELISA for measuring Bovine Transmembrane protein 173 (TMEM173) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Chicken Transmembrane protein 173 (TMEM173)
KTE30016-48T	Abbkine	48T	EUR 354
The deduced 379-amino acid protein has a calculated molecular mass of 42.2 kD. It has 5 putative N-terminal transmembrane domains, a signal cleavage site in the first transmembrane domain, and a leucine-rich region that overlaps the first 4 transmemb Show more
Description: Quantitative sandwich ELISA for measuring Chicken Transmembrane protein 173 (TMEM173) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Chicken Transmembrane protein 173 (TMEM173)
KTE30016-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
The deduced 379-amino acid protein has a calculated molecular mass of 42.2 kD. It has 5 putative N-terminal transmembrane domains, a signal cleavage site in the first transmembrane domain, and a leucine-rich region that overlaps the first 4 transmemb Show more
Description: Quantitative sandwich ELISA for measuring Chicken Transmembrane protein 173 (TMEM173) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Chicken Transmembrane protein 173 (TMEM173)
KTE30016-96T	Abbkine	96T	EUR 572
The deduced 379-amino acid protein has a calculated molecular mass of 42.2 kD. It has 5 putative N-terminal transmembrane domains, a signal cleavage site in the first transmembrane domain, and a leucine-rich region that overlaps the first 4 transmemb Show more
Description: Quantitative sandwich ELISA for measuring Chicken Transmembrane protein 173 (TMEM173) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Transmembrane protein 173 (TMEM173)
KTE70180-48T	Abbkine	48T	EUR 332
The deduced 379-amino acid protein has a calculated molecular mass of 42.2 kD. It has 5 putative N-terminal transmembrane domains, a signal cleavage site in the first transmembrane domain, and a leucine-rich region that overlaps the first 4 transmemb Show more
Description: Quantitative sandwich ELISA for measuring Mouse Transmembrane protein 173 (TMEM173) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Transmembrane protein 173 (TMEM173)
KTE70180-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
The deduced 379-amino acid protein has a calculated molecular mass of 42.2 kD. It has 5 putative N-terminal transmembrane domains, a signal cleavage site in the first transmembrane domain, and a leucine-rich region that overlaps the first 4 transmemb Show more
Description: Quantitative sandwich ELISA for measuring Mouse Transmembrane protein 173 (TMEM173) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Transmembrane protein 173 (TMEM173)
KTE70180-96T	Abbkine	96T	EUR 539
The deduced 379-amino acid protein has a calculated molecular mass of 42.2 kD. It has 5 putative N-terminal transmembrane domains, a signal cleavage site in the first transmembrane domain, and a leucine-rich region that overlaps the first 4 transmemb Show more
Description: Quantitative sandwich ELISA for measuring Mouse Transmembrane protein 173 (TMEM173) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Transmembrane Protein 173 (TMEM173) Polyclonal Antibody (Mouse)
4-PAN011Mu01	Cloud-Clone	EUR 266.00 EUR 2813.00 EUR 694.00 EUR 337.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TMEM173 (Trp160~Leu371) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Transmembrane Protein 173 (TMEM173)

Transmembrane Protein 173 (TMEM173) Polyclonal Antibody (Rat)
4-PAN011Ra01	Cloud-Clone	EUR 275.00 EUR 2958.00 EUR 727.00 EUR 350.00 EUR 226.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TMEM173 (Ala160~Leu363) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Transmembrane Protein 173 (TMEM173)

Transmembrane Protein 173 (TMEM173) Polyclonal Antibody (Human, Mouse)
4-PAN011Hu01	Cloud-Clone	EUR 261.00 EUR 2734.00 EUR 676.00 EUR 330.00 EUR 220.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TMEM173 (Leu159~Pro373) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Transmembrane Protein 173 (TMEM173)

Transmembrane Protein 173 (TMEM173) Polyclonal Antibody (Mouse), APC
4-PAN011Mu01-APC	Cloud-Clone	EUR 374.00 EUR 3689.00 EUR 1016.00 EUR 481.00 EUR 232.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TMEM173 (Trp160~Leu371) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Transmembrane Protein 173 (TMEM173). This antibody is labeled with APC.

Transmembrane Protein 173 (TMEM173) Polyclonal Antibody (Mouse), Biotinylated
4-PAN011Mu01-Biotin	Cloud-Clone	EUR 332.00 EUR 2763.00 EUR 803.00 EUR 411.00 EUR 228.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TMEM173 (Trp160~Leu371) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Transmembrane Protein 173 (TMEM173). This antibody is labeled with Biotin.

Transmembrane Protein 173 (TMEM173) Polyclonal Antibody (Mouse), Cy3
4-PAN011Mu01-Cy3	Cloud-Clone	EUR 457.00 EUR 4877.00 EUR 1313.00 EUR 600.00 EUR 267.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TMEM173 (Trp160~Leu371) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Transmembrane Protein 173 (TMEM173). This antibody is labeled with Cy3.

Transmembrane Protein 173 (TMEM173) Polyclonal Antibody (Mouse), FITC
4-PAN011Mu01-FITC	Cloud-Clone	EUR 319.00 EUR 2971.00 EUR 832.00 EUR 405.00 EUR 205.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TMEM173 (Trp160~Leu371) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Transmembrane Protein 173 (TMEM173). This antibody is labeled with FITC.

Transmembrane Protein 173 (TMEM173) Polyclonal Antibody (Mouse), HRP
4-PAN011Mu01-HRP	Cloud-Clone	EUR 341.00 EUR 3213.00 EUR 897.00 EUR 433.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TMEM173 (Trp160~Leu371) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Transmembrane Protein 173 (TMEM173). This antibody is labeled with HRP.

Transmembrane Protein 173 (TMEM173) Polyclonal Antibody (Mouse), PE
4-PAN011Mu01-PE	Cloud-Clone	EUR 319.00 EUR 2971.00 EUR 832.00 EUR 405.00 EUR 205.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TMEM173 (Trp160~Leu371) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Transmembrane Protein 173 (TMEM173). This antibody is labeled with PE.

Transmembrane Protein 173 (TMEM173) Polyclonal Antibody (Rat), APC
4-PAN011Ra01-APC	Cloud-Clone	EUR 388.00 EUR 3887.00 EUR 1065.00 EUR 501.00 EUR 237.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TMEM173 (Ala160~Leu363) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Transmembrane Protein 173 (TMEM173). This antibody is labeled with APC.

Transmembrane Protein 173 (TMEM173) Polyclonal Antibody (Rat), Biotinylated
4-PAN011Ra01-Biotin	Cloud-Clone	EUR 343.00 EUR 2908.00 EUR 839.00 EUR 425.00 EUR 232.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TMEM173 (Ala160~Leu363) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Transmembrane Protein 173 (TMEM173). This antibody is labeled with Biotin.

Transmembrane Protein 173 (TMEM173) Polyclonal Antibody (Rat), Cy3
4-PAN011Ra01-Cy3	Cloud-Clone	EUR 476.00 EUR 5141.00 EUR 1379.00 EUR 626.00 EUR 275.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TMEM173 (Ala160~Leu363) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Transmembrane Protein 173 (TMEM173). This antibody is labeled with Cy3.

Transmembrane Protein 173 (TMEM173) Polyclonal Antibody (Rat), FITC
4-PAN011Ra01-FITC	Cloud-Clone	EUR 330.00 EUR 3129.00 EUR 872.00 EUR 420.00 EUR 210.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TMEM173 (Ala160~Leu363) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Transmembrane Protein 173 (TMEM173). This antibody is labeled with FITC.

Transmembrane Protein 173 (TMEM173) Polyclonal Antibody (Rat), HRP
4-PAN011Ra01-HRP	Cloud-Clone	EUR 353.00 EUR 3385.00 EUR 940.00 EUR 451.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TMEM173 (Ala160~Leu363) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Transmembrane Protein 173 (TMEM173). This antibody is labeled with HRP.

Transmembrane Protein 173 (TMEM173) Polyclonal Antibody (Rat), PE
4-PAN011Ra01-PE	Cloud-Clone	EUR 330.00 EUR 3129.00 EUR 872.00 EUR 420.00 EUR 210.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TMEM173 (Ala160~Leu363) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Transmembrane Protein 173 (TMEM173). This antibody is labeled with PE.

Transmembrane Protein 173 (TMEM173) Polyclonal Antibody (Human, Mouse), APC
4-PAN011Hu01-APC	Cloud-Clone	EUR 367.00 EUR 3581.00 EUR 989.00 EUR 470.00 EUR 228.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TMEM173 (Leu159~Pro373) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Transmembrane Protein 173 (TMEM173). This antibody is labeled with APC.

Transmembrane Protein 173 (TMEM173) Polyclonal Antibody (Human, Mouse), Biotinylated
4-PAN011Hu01-Biotin	Cloud-Clone	EUR 327.00 EUR 2684.00 EUR 783.00 EUR 403.00 EUR 225.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TMEM173 (Leu159~Pro373) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Transmembrane Protein 173 (TMEM173). This antibody is labeled with Biotin.

Transmembrane Protein 173 (TMEM173) Polyclonal Antibody (Human, Mouse), Cy3
4-PAN011Hu01-Cy3	Cloud-Clone	EUR 447.00 EUR 4733.00 EUR 1277.00 EUR 585.00 EUR 263.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TMEM173 (Leu159~Pro373) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Transmembrane Protein 173 (TMEM173). This antibody is labeled with Cy3.

Transmembrane Protein 173 (TMEM173) Polyclonal Antibody (Human, Mouse), FITC
4-PAN011Hu01-FITC	Cloud-Clone	EUR 313.00 EUR 2884.00 EUR 811.00 EUR 396.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TMEM173 (Leu159~Pro373) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Transmembrane Protein 173 (TMEM173). This antibody is labeled with FITC.

Transmembrane Protein 173 (TMEM173) Polyclonal Antibody (Human, Mouse), HRP
4-PAN011Hu01-HRP	Cloud-Clone	EUR 334.00 EUR 3120.00 EUR 873.00 EUR 424.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TMEM173 (Leu159~Pro373) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Transmembrane Protein 173 (TMEM173). This antibody is labeled with HRP.

Transmembrane Protein 173 (TMEM173) Polyclonal Antibody (Human, Mouse), PE
4-PAN011Hu01-PE	Cloud-Clone	EUR 313.00 EUR 2884.00 EUR 811.00 EUR 396.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TMEM173 (Leu159~Pro373) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Transmembrane Protein 173 (TMEM173). This antibody is labeled with PE.

Transmembrane Protein 173 (TMEM173) Polyclonal Antibody (Mouse), APC-Cy7
4-PAN011Mu01-APC-Cy7	Cloud-Clone	EUR 628.00 EUR 7258.00 EUR 1912.00 EUR 842.00 EUR 344.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TMEM173 (Trp160~Leu371) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Transmembrane Protein 173 (TMEM173). This antibody is labeled with APC-Cy7.

Transmembrane Protein 173 (TMEM173) Polyclonal Antibody (Rat), APC-Cy7
4-PAN011Ra01-APC-Cy7	Cloud-Clone	EUR 657.00 EUR 7654.00 EUR 2011.00 EUR 882.00 EUR 355.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TMEM173 (Ala160~Leu363) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Transmembrane Protein 173 (TMEM173). This antibody is labeled with APC-Cy7.

Transmembrane Protein 173 (TMEM173) Polyclonal Antibody (Human, Mouse), APC-Cy7
4-PAN011Hu01-APC-Cy7	Cloud-Clone	EUR 614.00 EUR 7042.00 EUR 1858.00 EUR 821.00 EUR 337.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TMEM173 (Leu159~Pro373) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Transmembrane Protein 173 (TMEM173). This antibody is labeled with APC-Cy7.

Transmembrane Protein 173 (TM173) Antibody
abx034495-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Transmembrane Protein 173 (TM173) Antibody
abx034495-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Transmembrane Protein 173 (TM173) Antibody
abx034525-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Transmembrane Protein 173 (TM173) Antibody
abx034525-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

TMEM173 ELISA KIT|Human
EF003662	Lifescience Market	96 Tests	EUR 689

TMEM173 ELISA Kit (Human) (OKCD00623)
OKCD00623	Aviva Systems Biology	96 Wells	EUR 909
Description: Description of target: This gene encodes a five transmembrane protein that functions as a major regulator of the innate immune response to viral and bacterial infections. The encoded protein is a pattern recognition receptor that detects cytosolic nucleic acids and transmits signals that activate type I interferon responses. The encoded protein has also been shown to play a role in apoptotic signaling by associating with type II major histocompatibility complex. Mutations in this gene are the cause of infantile-onset STING-associated vasculopathy. Alternate splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.055 ng/mL

TMEM173 Recombinant Protein (Human)
RP032008	ABM	100 ug	Ask for price

TMEM173 ELISA Kit (Chicken) (OKCA02019)
OKCA02019	Aviva Systems Biology	96 Wells	EUR 917
Description: Description of target: Facilitator of innate immune signaling that acts as a sensor of cytosolic DNA from bacteria and viruses and promotes the production of type I interferon (IFN-alpha and IFN-beta). Innate immune response is triggered in response to non-CpG double-stranded DNA from viruses and bacteria delivered to the cytoplasm. Acts by recognizing and binding cyclic di-GMP (c-di-GMP), a second messenger produced by bacteria, and cyclic GMP-AMP (cGAMP), a messenger produced in response to DNA virus in the cytosol: upon binding of c-di-GMP or cGAMP, autoinhibition is alleviated and TMEM173/STING is able to activate both NF-kappa-B and IRF3 transcription pathways to induce expression of type I interferon and exert a potent anti-viral state.;Species reactivity: Chicken;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 7.8 pg/mL

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

TMEM173 siRNA
20-abx937153	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TMEM173 siRNA
20-abx937154	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TMEM173 antibody
70R-20869	Fitzgerald	50 ug	EUR 435
Description: Rabbit polyclonal TMEM173 antibody

TMEM173 antibody
70R-2359	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal TMEM173 antibody raised against the middle region of TMEM173

TMEM173 Antibody
49658-100ul	SAB	100ul	EUR 333

TMEM173 Antibody
49658-50ul	SAB	50ul	EUR 239

TMEM173 Antibody
1-CSB-PA005903	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TMEM173. Recognizes TMEM173 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

TMEM173 Antibody
1-CSB-PA023754GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TMEM173. Recognizes TMEM173 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF, FC

TMEM173 Antibody
1-CSB-PA023754LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TMEM173. Recognizes TMEM173 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:200-1:500, IF:1:50-1:200

APF LB Broth Miller
173	AthenaES	500 ml	EUR 68

TMEM173 Recombinant Protein (Mouse)
RP179423	ABM	100 ug	Ask for price

Human Transmembrane protein 119 ELISA kit
E01T0877-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Transmembrane protein 119 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 119 ELISA kit
E01T0877-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Transmembrane protein 119 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 119 ELISA kit
E01T0877-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Transmembrane protein 119 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human TMEM173 shRNA Plasmid
20-abx967322	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Recombinant Human C1QTNF6 Protein-6His-ABP tag
CTP-173	Creative Biolabs	100ug	Ask for price
Description: A 32 kDa recombinant human C1QTNF6 protein Antigen with a GST-tag at N-terminal expressed in E. Coli.

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

HS-173
B1627-25	Biovision		EUR 436

HS-173
B1627-5	Biovision		EUR 147

HS-173
B4492-25	ApexBio	25 mg	EUR 325
Description: Phosphatidylinositol 3-kinase (PI3K) was first identified over 20 years ago as a lipid kinase associated with viral oncoproteins.

HS-173
B4492-5	ApexBio	5 mg	EUR 128
Description: Phosphatidylinositol 3-kinase (PI3K) was first identified over 20 years ago as a lipid kinase associated with viral oncoproteins.

HS-173
B4492-5.1	ApexBio	10 mM (in 1mL DMSO)	EUR 154
Description: Phosphatidylinositol 3-kinase (PI3K) was first identified over 20 years ago as a lipid kinase associated with viral oncoproteins.

HS-173
HY-15868	MedChemExpress	50mg	EUR 670

Human Probable G- protein coupled receptor 173, GPR173 ELISA KIT
ELI-27266h	Lifescience Market	96 Tests	EUR 824

TMEM173 Conjugated Antibody
C49658	SAB	100ul	EUR 397

TMEM173 cloning plasmid
CSB-CL023754HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1140 Sequence: atgccccactccagcctgcatccatccatcccgtgtcccaggggtcacggggcccagaaggcagccttggttctgctgagtgcctgcctggtgaccctttgggggctaggagagccaccagagcacactctccggtacctggtgctccacctagcctccctgcagctgggactgc Show more
Description: A cloning plasmid for the TMEM173 gene.

TMEM173 Polyclonal Antibody
ES4218-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against TMEM173 from Human/Mouse. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

TMEM173 Polyclonal Antibody
ES4218-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against TMEM173 from Human/Mouse. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

anti- TMEM173 antibody
FNab08759	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:100 Immunogen: transmembrane protein 173 Uniprot ID: Q86WV6 Gene ID: 340061 Research Area: Cancer, Immunology, Epigenetics
Description: Antibody raised against TMEM173

TMEM173 Polyclonal Antibody
ABP53219-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from the C-terminal region of human TMEM173 Applications tips:
Description: A polyclonal antibody for detection of TMEM173 from Human, Mouse. This TMEM173 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human TMEM173

TMEM173 Polyclonal Antibody
ABP53219-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from the C-terminal region of human TMEM173 Applications tips:
Description: A polyclonal antibody for detection of TMEM173 from Human, Mouse. This TMEM173 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human TMEM173

TMEM173 Polyclonal Antibody
ABP53219-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from the C-terminal region of human TMEM173 Applications tips:
Description: A polyclonal antibody for detection of TMEM173 from Human, Mouse. This TMEM173 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human TMEM173

TMEM173 Blocking Peptide
33R-2109	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TMEM173 antibody, catalog no. 70R-2359

TMEM173 Polyclonal Antibody
41859-100ul	SAB	100ul	EUR 252

TMEM173 Polyclonal Antibody
41859-50ul	SAB	50ul	EUR 187

TMEM173/STING Antibody
DF12090	Affbiotech	200ul	EUR 304
Description: TMEM173/STING antibody detects endogenous levels of TMEM173/STING.

Anti-TMEM173 Antibody
PB9513	BosterBio	100ug/vial	EUR 334

Anti-TMEM173 antibody
PAab08759	Lifescience Market	100 ug	EUR 386

pCMV-SPORT6-TMEM173
PVT18135	Lifescience Market	2 ug	EUR 231

Anti-TMEM173 antibody
STJ96853	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to TMEM173.

Anti-TMEM173 antibody
STJ25875	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a five transmembrane protein that functions as a major regulator of the innate immune response to viral and bacterial infections. The encoded protein is a pattern recognition receptor that detects cytosolic nucleic acids and transmits signals that activate type I interferon responses. The encoded protein has also been shown to play a role in apoptotic signaling by associating with type II major histocompatibility complex. Mutations in this gene are the cause of infantile-onset STING-associated vasculopathy. Alternate splicing results in multiple transcript variants.

Anti-TMEM173 antibody
STJ111179	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a five transmembrane protein that functions as a major regulator of the innate immune response to viral and bacterial infections. The encoded protein is a pattern recognition receptor that detects cytosolic nucleic acids and transmits signals that activate type I interferon responses. The encoded protein has also been shown to play a role in apoptotic signaling by associating with type II major histocompatibility complex. Mutations in this gene are the cause of infantile-onset STING-associated vasculopathy. Alternate splicing results in multiple transcript variants.

Human Transmembrane protein 104(TMEM104) ELISA kit
E01T0699-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 104(TMEM104) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 104(TMEM104) ELISA kit
E01T0699-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 104(TMEM104) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 104(TMEM104) ELISA kit
E01T0699-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 104(TMEM104) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 121(TMEM121) ELISA kit
E01T0701-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 121(TMEM121) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 121(TMEM121) ELISA kit
E01T0701-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 121(TMEM121) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 121(TMEM121) ELISA kit
E01T0701-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 121(TMEM121) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 129(TMEM129) ELISA kit
E01T0702-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 129(TMEM129) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 129(TMEM129) ELISA kit
E01T0702-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 129(TMEM129) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 129(TMEM129) ELISA kit
E01T0702-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 129(TMEM129) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 170A(TMEM170A) ELISA kit
E01T0703-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 170A(TMEM170A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 170A(TMEM170A) ELISA kit
E01T0703-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 170A(TMEM170A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 170A(TMEM170A) ELISA kit
E01T0703-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 170A(TMEM170A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 175(TMEM175) ELISA kit
E01T0705-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 175(TMEM175) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 175(TMEM175) ELISA kit
E01T0705-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 175(TMEM175) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 175(TMEM175) ELISA kit
E01T0705-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 175(TMEM175) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 18(TMEM18) ELISA kit
E01T0706-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 18(TMEM18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 18(TMEM18) ELISA kit
E01T0706-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 18(TMEM18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 18(TMEM18) ELISA kit
E01T0706-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 18(TMEM18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 180(TMEM180) ELISA kit
E01T0707-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 180(TMEM180) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 180(TMEM180) ELISA kit
E01T0707-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 180(TMEM180) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 180(TMEM180) ELISA kit
E01T0707-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 180(TMEM180) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 184C(TMEM184C) ELISA kit
E01T0708-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 184C(TMEM184C) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 184C(TMEM184C) ELISA kit
E01T0708-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 184C(TMEM184C) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 184C(TMEM184C) ELISA kit
E01T0708-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 184C(TMEM184C) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 194B(TMEM194B) ELISA kit
E01T0709-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 194B(TMEM194B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 194B(TMEM194B) ELISA kit
E01T0709-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 194B(TMEM194B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 194B(TMEM194B) ELISA kit
E01T0709-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 194B(TMEM194B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 208(TMEM208) ELISA kit
E01T0710-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 208(TMEM208) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 208(TMEM208) ELISA kit
E01T0710-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 208(TMEM208) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 208(TMEM208) ELISA kit
E01T0710-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 208(TMEM208) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 22(TMEM22) ELISA kit
E01T0711-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 22(TMEM22) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 22(TMEM22) ELISA kit
E01T0711-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 22(TMEM22) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 22(TMEM22) ELISA kit
E01T0711-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 22(TMEM22) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 41B(TMEM41B) ELISA kit
E01T0713-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 41B(TMEM41B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 41B(TMEM41B) ELISA kit
E01T0713-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 41B(TMEM41B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 41B(TMEM41B) ELISA kit
E01T0713-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 41B(TMEM41B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 68(TMEM68) ELISA kit
E01T0714-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 68(TMEM68) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 68(TMEM68) ELISA kit
E01T0714-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 68(TMEM68) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 68(TMEM68) ELISA kit
E01T0714-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 68(TMEM68) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human Transmembrane protein 158
EK2693	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Transmembrane protein 158 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Transmembrane protein 132D
EK4617	SAB	96 tests	EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Transmembrane protein 132D in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Transmembrane protein 126A
EK4626	SAB	96 tests	EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Transmembrane protein 126A in samples from serum, plasma, tissue homogenates and other biological fluids.

Human TMEM127(Transmembrane protein 127) ELISA Kit
EH4117	FN Test	96T	EUR 524.1
Detection range: 78-5000 pg/ml Uniprot ID: O75204
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml

Human TMEM126A/ Transmembrane protein 126A ELISA Kit
E2519Hu	Sunlong	1 Kit	EUR 605

Human TMEM132D/ Transmembrane protein 132D ELISA Kit
E2520Hu	Sunlong	1 Kit	EUR 605

Human TMEM158/ Transmembrane protein 158 ELISA Kit
E2521Hu	Sunlong	1 Kit	EUR 571

Human TMEM158(Transmembrane protein 158) ELISA Kit
EH1212	FN Test	96T	EUR 567.6
Detection range: 0.156-10 ng/ml Uniprot ID: Q8WZ71 Alias: TMEM158/Transmembrane protein 158/40 kDa BINP-binding protein/p40BBP/Ras-induced senescence protein 1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human TMEM132D(Transmembrane protein 132D) ELISA Kit
EH2284	FN Test	96T	EUR 567.6
Detection range: 0.156-10 ng/ml Uniprot ID: Q14C87 Alias: TMEM132D/Transmembrane protein 132D/Mature oligodendrocytes transmembrane protein(Mature OL transmembrane protein)
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human TMEM126A(Transmembrane protein 126A) ELISA Kit
EH2289	FN Test	96T	EUR 567.6
Detection range: 0.156-10 ng/ml Uniprot ID: Q9H061 Alias: TMEM126A
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Transmembrane protein C20orf46, C20orf46 ELISA KIT
ELI-10133h	Lifescience Market	96 Tests	EUR 824

Human Transmembrane protein C9orf71, C9orf71 ELISA KIT
ELI-10273h	Lifescience Market	96 Tests	EUR 824

Human Transmembrane protein C9orf91, C9orf91 ELISA KIT
ELI-10653h	Lifescience Market	96 Tests	EUR 824

Human Transmembrane protein C9orf123, C9orf123 ELISA KIT
ELI-10970h	Lifescience Market	96 Tests	EUR 824

Human Transmembrane protein C9orf125, C9orf125 ELISA KIT
ELI-10971h	Lifescience Market	96 Tests	EUR 824

Human Transmembrane protein 106B, TMEM106B ELISA KIT
ELI-13690h	Lifescience Market	96 Tests	EUR 824

Human Transmembrane protein 183B, TMEM183B ELISA KIT
ELI-13712h	Lifescience Market	96 Tests	EUR 824

Human Transmembrane protein 229B, TMEM229B ELISA KIT
ELI-18570h	Lifescience Market	96 Tests	EUR 824

Human Transmembrane protein 132E, TMEM132E ELISA KIT
ELI-18753h	Lifescience Market	96 Tests	EUR 824

Human Transmembrane protein 150B, TMEM150B ELISA KIT
ELI-18754h	Lifescience Market	96 Tests	EUR 824

Human Transmembrane protein 194B, TMEM194B ELISA KIT
ELI-18755h	Lifescience Market	96 Tests	EUR 824

Human Transmembrane protein 104, TMEM104 ELISA KIT
ELI-22923h	Lifescience Market	96 Tests	EUR 824

Human Transmembrane protein 110, TMEM110 ELISA KIT
ELI-22925h	Lifescience Market	96 Tests	EUR 824

Human Transmembrane protein 143, TMEM143 ELISA KIT
ELI-22927h	Lifescience Market	96 Tests	EUR 824

Human Transmembrane protein 205, TMEM205 ELISA KIT
ELI-22933h	Lifescience Market	96 Tests	EUR 824

Human Transmembrane protein 39B, TMEM39B ELISA KIT
ELI-22937h	Lifescience Market	96 Tests	EUR 824

Human Transmembrane protein 26, TMEM26 ELISA KIT
ELI-22980h	Lifescience Market	96 Tests	EUR 824

Human Transmembrane protein 80, TMEM80 ELISA KIT
ELI-22984h	Lifescience Market	96 Tests	EUR 824

Human Transmembrane protein 132A, TMEM132A ELISA KIT
ELI-23553h	Lifescience Market	96 Tests	EUR 824

Human Transmembrane protein C2orf18, C2orf18 ELISA KIT
ELI-24968h	Lifescience Market	96 Tests	EUR 824

Human Transmembrane protein C1orf70, C1orf70 ELISA KIT
ELI-25022h	Lifescience Market	96 Tests	EUR 824

Human Transmembrane protein C9orf46, C9orf46 ELISA KIT
ELI-25290h	Lifescience Market	96 Tests	EUR 824

Human Transmembrane protein C9orf5, C9orf5 ELISA KIT
ELI-25647h	Lifescience Market	96 Tests	EUR 824

Human Transmembrane protein C10orf57, C10orf57 ELISA KIT
ELI-25797h	Lifescience Market	96 Tests	EUR 824

Human Transmembrane protein C7orf23, C7orf23 ELISA KIT
ELI-25903h	Lifescience Market	96 Tests	EUR 824

Human Transmembrane protein C18orf45, C18orf45 ELISA KIT
ELI-26110h	Lifescience Market	96 Tests	EUR 824

Human Transmembrane protein C16orf54, C16orf54 ELISA KIT
ELI-26166h	Lifescience Market	96 Tests	EUR 824

Human Transmembrane protein 158, TMEM158 ELISA KIT
ELI-03517h	Lifescience Market	96 Tests	EUR 824

Human Transmembrane protein 206, TMEM206 ELISA KIT
ELI-16076h	Lifescience Market	96 Tests	EUR 824

Human Transmembrane protein 213, TMEM213 ELISA KIT
ELI-16078h	Lifescience Market	96 Tests	EUR 824

Human Transmembrane protein 214, TMEM214 ELISA KIT
ELI-16079h	Lifescience Market	96 Tests	EUR 824

Human Transmembrane protein 235, TMEM235 ELISA KIT
ELI-16080h	Lifescience Market	96 Tests	EUR 824

Human Transmembrane protein 50B, TMEM50B ELISA KIT
ELI-16083h	Lifescience Market	96 Tests	EUR 824

Human Transmembrane protein 88B, TMEM88B ELISA KIT
ELI-16086h	Lifescience Market	96 Tests	EUR 824

Human Transmembrane protein 9, TMEM9 ELISA KIT
ELI-16307h	Lifescience Market	96 Tests	EUR 824

Human Transmembrane protein 25, TMEM25 ELISA KIT
ELI-16310h	Lifescience Market	96 Tests	EUR 824

Human Transmembrane protein 52, TMEM52 ELISA KIT
ELI-16312h	Lifescience Market	96 Tests	EUR 824

Human Transmembrane protein 60, TMEM60 ELISA KIT
ELI-16314h	Lifescience Market	96 Tests	EUR 824

Human Transmembrane protein 111, TMEM111 ELISA KIT
ELI-17099h	Lifescience Market	96 Tests	EUR 824

Human Transmembrane protein 139, TMEM139 ELISA KIT
ELI-17102h	Lifescience Market	96 Tests	EUR 824

Human Transmembrane protein 154, TMEM154 ELISA KIT
ELI-17104h	Lifescience Market	96 Tests	EUR 824

Human Transmembrane protein 204, TMEM204 ELISA KIT
ELI-17111h	Lifescience Market	96 Tests	EUR 824

Human Transmembrane protein 50A, TMEM50A ELISA KIT
ELI-17117h	Lifescience Market	96 Tests	EUR 824

Human Transmembrane protein 53, TMEM53 ELISA KIT
ELI-17124h	Lifescience Market	96 Tests	EUR 824

Human Transmembrane protein 72, TMEM72 ELISA KIT
ELI-17128h	Lifescience Market	96 Tests	EUR 824

Human Transmembrane protein 82, TMEM82 ELISA KIT
ELI-17130h	Lifescience Market	96 Tests	EUR 824

Human Transmembrane protein 92, TMEM92 ELISA KIT
ELI-17132h	Lifescience Market	96 Tests	EUR 824

Human Transmembrane protein 42, TMEM42 ELISA KIT
ELI-17216h	Lifescience Market	96 Tests	EUR 824

Human Transmembrane protein 68, TMEM68 ELISA KIT
ELI-17218h	Lifescience Market	96 Tests	EUR 824

Human Transmembrane protein 9B, TMEM9B ELISA KIT
ELI-17219h	Lifescience Market	96 Tests	EUR 824

Human Transmembrane protein 87A, TMEM87A ELISA KIT
ELI-17246h	Lifescience Market	96 Tests	EUR 824

Human Transmembrane protein 43, TMEM43 ELISA KIT
ELI-17261h	Lifescience Market	96 Tests	EUR 824

Human Transmembrane protein 71, TMEM71 ELISA KIT
ELI-17265h	Lifescience Market	96 Tests	EUR 824

Human Transmembrane protein 78, TMEM78 ELISA KIT
ELI-17266h	Lifescience Market	96 Tests	EUR 824

Human Transmembrane protein 97, TMEM97 ELISA KIT
ELI-17270h	Lifescience Market	96 Tests	EUR 824

Human Transmembrane protein 14D, TMEM14D ELISA KIT
ELI-17327h	Lifescience Market	96 Tests	EUR 824

Human Transmembrane protein 165, TMEM165 ELISA KIT
ELI-17328h	Lifescience Market	96 Tests	EUR 824

Human Transmembrane protein 171, TMEM171 ELISA KIT
ELI-17331h	Lifescience Market	96 Tests	EUR 824

Human Transmembrane protein 198, TMEM198 ELISA KIT
ELI-17334h	Lifescience Market	96 Tests	EUR 824

Human Transmembrane protein 199, TMEM199 ELISA KIT
ELI-17335h	Lifescience Market	96 Tests	EUR 824

Human Transmembrane protein 234, TMEM234 ELISA KIT
ELI-17340h	Lifescience Market	96 Tests	EUR 824

Human Transmembrane protein 136, TMEM136 ELISA KIT
ELI-17348h	Lifescience Market	96 Tests	EUR 824

Human Transmembrane protein 14A, TMEM14A ELISA KIT
ELI-17351h	Lifescience Market	96 Tests	EUR 824

Human Transmembrane protein 187, TMEM187 ELISA KIT
ELI-17356h	Lifescience Market	96 Tests	EUR 824

Human Transmembrane protein 220, TMEM220 ELISA KIT
ELI-17361h	Lifescience Market	96 Tests	EUR 824

Human Transmembrane protein 45B, TMEM45B ELISA KIT
ELI-17365h	Lifescience Market	96 Tests	EUR 824

Human Transmembrane protein C17orf87, C17orf87 ELISA KIT
ELI-09071h	Lifescience Market	96 Tests	EUR 824

Human Transmembrane protein 222, TMEM222 ELISA KIT
ELI-28228h	Lifescience Market	96 Tests	EUR 824

Human Transmembrane protein 41A, TMEM41A ELISA KIT
ELI-28229h	Lifescience Market	96 Tests	EUR 824

Human Transmembrane protein 63B, TMEM63B ELISA KIT
ELI-28232h	Lifescience Market	96 Tests	EUR 824

Human Transmembrane protein 19, TMEM19 ELISA KIT
ELI-51820h	Lifescience Market	96 Tests	EUR 824

Human Transmembrane protein 115, TMEM115 ELISA KIT
ELI-51903h	Lifescience Market	96 Tests	EUR 824

Human Transmembrane protein 125, TMEM125 ELISA KIT
ELI-51904h	Lifescience Market	96 Tests	EUR 824

Human TMEM173(Transmembrane Protein 173) ELISA Kit