Human TMEM173(Transmembrane Protein 173) ELISA Kit
To Order Contact us: [email protected]
Human Transmembrane Protein 173 (TMEM173) ELISA Kit |
20-abx258669 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Transmembrane Protein 173 (TMEM173) ELISA Kit |
SEN011Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5189.65 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transmembrane Protein 173 (TMEM173) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay:
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transmembrane Protein 173 (TMEM173) in Tissue homogenates, cell lysates and other biological fluids. |
Human Transmembrane Protein 173 (TMEM173) ELISA Kit |
SEN011Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 515.03 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transmembrane Protein 173 (TMEM173) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay:
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transmembrane Protein 173 (TMEM173) in Tissue homogenates, cell lysates and other biological fluids. |
Human Transmembrane Protein 173 (TMEM173) ELISA Kit |
SEN011Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 692.9 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transmembrane Protein 173 (TMEM173) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay:
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transmembrane Protein 173 (TMEM173) in Tissue homogenates, cell lysates and other biological fluids. |
Human Transmembrane Protein 173 (TMEM173) ELISA Kit |
SEN011Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2818.05 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transmembrane Protein 173 (TMEM173) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay:
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transmembrane Protein 173 (TMEM173) in Tissue homogenates, cell lysates and other biological fluids. |
Human Transmembrane Protein 173 (TMEM173) ELISA Kit |
4-SEN011Hu |
Cloud-Clone |
-
EUR 5240.00
-
EUR 2769.00
-
EUR 693.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Transmembrane Protein 173 elisa. Alternative names of the recognized antigen: NET23
- ERIS
- MPYS
- MITA
- STING
- Endoplasmic Reticulum Interferon Stimulator
- Stimulator Of Interferon Genes Protein
- Mediator of IRF3 activation
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Transmembrane Protein 173 (TMEM173) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Human Transmembrane Protein 173 (TMEM173) Protein |
20-abx069447 |
Abbexa |
-
EUR 648.00
-
EUR 272.00
-
EUR 1943.00
-
EUR 759.00
-
EUR 467.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Transmembrane Protein 173 (TMEM173) Antibody |
20-abx116240 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Transmembrane Protein 173 (TMEM173) Antibody |
20-abx129806 |
Abbexa |
-
EUR 467.00
-
EUR 133.00
-
EUR 1344.00
-
EUR 634.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Transmembrane Protein 173 (TMEM173) Antibody |
20-abx102945 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1302.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Transmembrane Protein 173 (TMEM173) Antibody |
20-abx102946 |
Abbexa |
-
EUR 481.00
-
EUR 133.00
-
EUR 1414.00
-
EUR 662.00
-
EUR 356.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Transmembrane Protein 173 (TMEM173) Antibody |
20-abx325479 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Recombinant Transmembrane Protein 173 (TMEM173) |
4-RPN011Hu01 |
Cloud-Clone |
-
EUR 458.40
-
EUR 226.00
-
EUR 1444.00
-
EUR 548.00
-
EUR 996.00
-
EUR 370.00
-
EUR 3460.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q86WV6
- Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 28.2kDa
- Isoelectric Point: 5.8
|
Description: Recombinant Human Transmembrane Protein 173 expressed in: E.coli |
Recombinant Transmembrane Protein 173 (TMEM173) |
4-RPN011Mu01 |
Cloud-Clone |
-
EUR 485.28
-
EUR 233.00
-
EUR 1544.80
-
EUR 581.60
-
EUR 1063.20
-
EUR 388.00
-
EUR 3712.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q3TBT3
- Buffer composition: 100mMNaHCO3, 500mMNaCl, pH8.3, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 27.8kDa
- Isoelectric Point: 5.2
|
Description: Recombinant Mouse Transmembrane Protein 173 expressed in: E.coli |
Recombinant Transmembrane Protein 173 (TMEM173) |
4-RPN011Ra01 |
Cloud-Clone |
-
EUR 494.24
-
EUR 235.00
-
EUR 1578.40
-
EUR 592.80
-
EUR 1085.60
-
EUR 394.00
-
EUR 3796.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: F1M391
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 26.9kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Rat Transmembrane Protein 173 expressed in: E.coli |
Mouse Transmembrane protein 173(TMEM173) ELISA kit |
E03T0704-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Transmembrane protein 173(TMEM173) ELISA kit |
E03T0704-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Transmembrane protein 173(TMEM173) ELISA kit |
E03T0704-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Transmembrane protein 173(TMEM173) ELISA kit |
E02T0704-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Transmembrane protein 173(TMEM173) ELISA kit |
E02T0704-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Transmembrane protein 173(TMEM173) ELISA kit |
E02T0704-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Transmembrane protein 173(TMEM173) ELISA kit |
E04T0704-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Transmembrane protein 173(TMEM173) ELISA kit |
E04T0704-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Transmembrane protein 173(TMEM173) ELISA kit |
E04T0704-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Transmembrane protein 173(TMEM173) ELISA kit |
E08T0704-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Transmembrane protein 173(TMEM173) ELISA kit |
E08T0704-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Transmembrane protein 173(TMEM173) ELISA kit |
E08T0704-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Transmembrane protein 173(TMEM173) ELISA kit |
E07T0704-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Transmembrane protein 173(TMEM173) ELISA kit |
E07T0704-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Transmembrane protein 173(TMEM173) ELISA kit |
E07T0704-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Transmembrane protein 173(TMEM173) ELISA kit |
E06T0704-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Transmembrane protein 173(TMEM173) ELISA kit |
E06T0704-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Transmembrane protein 173(TMEM173) ELISA kit |
E06T0704-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Transmembrane protein 173(TMEM173) ELISA kit |
E09T0704-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Transmembrane protein 173(TMEM173) ELISA kit |
E09T0704-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Transmembrane protein 173(TMEM173) ELISA kit |
E09T0704-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Chicken Transmembrane protein 173, TMEM173 ELISA KIT |
ELI-17107c |
Lifescience Market |
96 Tests |
EUR 928 |
Mouse Transmembrane protein 173, Tmem173 ELISA KIT |
ELI-37526m |
Lifescience Market |
96 Tests |
EUR 865 |
Porcine Transmembrane protein 173, TMEM173 ELISA KIT |
ELI-39868p |
Lifescience Market |
96 Tests |
EUR 928 |
Bovine Transmembrane protein 173, TMEM173 ELISA KIT |
ELI-41973b |
Lifescience Market |
96 Tests |
EUR 928 |
Human Transmembrane Protein 173 (TMEM173) CLIA Kit |
20-abx496082 |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
ELISA kit for Human TMEM173 (Transmembrane Protein 173) |
ELK7591 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Transmembrane Protein 173 (TMEM173). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific t
- Show more
|
Description: A sandwich ELISA kit for detection of Transmembrane Protein 173 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Human Transmembrane protein 173 (TMEM173) |
KTE60282-48T |
Abbkine |
48T |
EUR 332 |
- The deduced 379-amino acid protein has a calculated molecular mass of 42.2 kD. It has 5 putative N-terminal transmembrane domains, a signal cleavage site in the first transmembrane domain, and a leucine-rich region that overlaps the first 4 transmemb
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Transmembrane protein 173 (TMEM173) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Transmembrane protein 173 (TMEM173) |
KTE60282-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- The deduced 379-amino acid protein has a calculated molecular mass of 42.2 kD. It has 5 putative N-terminal transmembrane domains, a signal cleavage site in the first transmembrane domain, and a leucine-rich region that overlaps the first 4 transmemb
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Transmembrane protein 173 (TMEM173) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Transmembrane protein 173 (TMEM173) |
KTE60282-96T |
Abbkine |
96T |
EUR 539 |
- The deduced 379-amino acid protein has a calculated molecular mass of 42.2 kD. It has 5 putative N-terminal transmembrane domains, a signal cleavage site in the first transmembrane domain, and a leucine-rich region that overlaps the first 4 transmemb
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Transmembrane protein 173 (TMEM173) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Rat Transmembrane Protein 173 (TMEM173) Protein |
20-abx069448 |
Abbexa |
-
EUR 690.00
-
EUR 286.00
-
EUR 2124.00
-
EUR 815.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Mouse Transmembrane Protein 173 (TMEM173) Protein |
20-abx165931 |
Abbexa |
-
EUR 676.00
-
EUR 286.00
-
EUR 2082.00
-
EUR 801.00
-
EUR 481.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Transmembrane Protein 173 (TMEM173) Antibody (FITC) |
20-abx274261 |
Abbexa |
-
EUR 509.00
-
EUR 258.00
-
EUR 1539.00
-
EUR 718.00
-
EUR 411.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Guinea pig Transmembrane protein 173(TMEM173) ELISA kit |
E05T0704-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Transmembrane protein 173(TMEM173) ELISA kit |
E05T0704-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Transmembrane protein 173(TMEM173) ELISA kit |
E05T0704-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
ELISA kit for Pig Transmembrane protein 173 (TMEM173) |
KTE80020-48T |
Abbkine |
48T |
EUR 354 |
- The deduced 379-amino acid protein has a calculated molecular mass of 42.2 kD. It has 5 putative N-terminal transmembrane domains, a signal cleavage site in the first transmembrane domain, and a leucine-rich region that overlaps the first 4 transmemb
- Show more
|
Description: Quantitative sandwich ELISA for measuring Pig Transmembrane protein 173 (TMEM173) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Pig Transmembrane protein 173 (TMEM173) |
KTE80020-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2252 |
- The deduced 379-amino acid protein has a calculated molecular mass of 42.2 kD. It has 5 putative N-terminal transmembrane domains, a signal cleavage site in the first transmembrane domain, and a leucine-rich region that overlaps the first 4 transmemb
- Show more
|
Description: Quantitative sandwich ELISA for measuring Pig Transmembrane protein 173 (TMEM173) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Pig Transmembrane protein 173 (TMEM173) |
KTE80020-96T |
Abbkine |
96T |
EUR 572 |
- The deduced 379-amino acid protein has a calculated molecular mass of 42.2 kD. It has 5 putative N-terminal transmembrane domains, a signal cleavage site in the first transmembrane domain, and a leucine-rich region that overlaps the first 4 transmemb
- Show more
|
Description: Quantitative sandwich ELISA for measuring Pig Transmembrane protein 173 (TMEM173) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Bovine Transmembrane protein 173 (TMEM173) |
KTE10047-48T |
Abbkine |
48T |
EUR 354 |
- The deduced 379-amino acid protein has a calculated molecular mass of 42.2 kD. It has 5 putative N-terminal transmembrane domains, a signal cleavage site in the first transmembrane domain, and a leucine-rich region that overlaps the first 4 transmemb
- Show more
|
Description: Quantitative sandwich ELISA for measuring Bovine Transmembrane protein 173 (TMEM173) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Bovine Transmembrane protein 173 (TMEM173) |
KTE10047-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2252 |
- The deduced 379-amino acid protein has a calculated molecular mass of 42.2 kD. It has 5 putative N-terminal transmembrane domains, a signal cleavage site in the first transmembrane domain, and a leucine-rich region that overlaps the first 4 transmemb
- Show more
|
Description: Quantitative sandwich ELISA for measuring Bovine Transmembrane protein 173 (TMEM173) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Bovine Transmembrane protein 173 (TMEM173) |
KTE10047-96T |
Abbkine |
96T |
EUR 572 |
- The deduced 379-amino acid protein has a calculated molecular mass of 42.2 kD. It has 5 putative N-terminal transmembrane domains, a signal cleavage site in the first transmembrane domain, and a leucine-rich region that overlaps the first 4 transmemb
- Show more
|
Description: Quantitative sandwich ELISA for measuring Bovine Transmembrane protein 173 (TMEM173) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Chicken Transmembrane protein 173 (TMEM173) |
KTE30016-48T |
Abbkine |
48T |
EUR 354 |
- The deduced 379-amino acid protein has a calculated molecular mass of 42.2 kD. It has 5 putative N-terminal transmembrane domains, a signal cleavage site in the first transmembrane domain, and a leucine-rich region that overlaps the first 4 transmemb
- Show more
|
Description: Quantitative sandwich ELISA for measuring Chicken Transmembrane protein 173 (TMEM173) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Chicken Transmembrane protein 173 (TMEM173) |
KTE30016-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2252 |
- The deduced 379-amino acid protein has a calculated molecular mass of 42.2 kD. It has 5 putative N-terminal transmembrane domains, a signal cleavage site in the first transmembrane domain, and a leucine-rich region that overlaps the first 4 transmemb
- Show more
|
Description: Quantitative sandwich ELISA for measuring Chicken Transmembrane protein 173 (TMEM173) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Chicken Transmembrane protein 173 (TMEM173) |
KTE30016-96T |
Abbkine |
96T |
EUR 572 |
- The deduced 379-amino acid protein has a calculated molecular mass of 42.2 kD. It has 5 putative N-terminal transmembrane domains, a signal cleavage site in the first transmembrane domain, and a leucine-rich region that overlaps the first 4 transmemb
- Show more
|
Description: Quantitative sandwich ELISA for measuring Chicken Transmembrane protein 173 (TMEM173) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Transmembrane protein 173 (TMEM173) |
KTE70180-48T |
Abbkine |
48T |
EUR 332 |
- The deduced 379-amino acid protein has a calculated molecular mass of 42.2 kD. It has 5 putative N-terminal transmembrane domains, a signal cleavage site in the first transmembrane domain, and a leucine-rich region that overlaps the first 4 transmemb
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Transmembrane protein 173 (TMEM173) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Transmembrane protein 173 (TMEM173) |
KTE70180-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- The deduced 379-amino acid protein has a calculated molecular mass of 42.2 kD. It has 5 putative N-terminal transmembrane domains, a signal cleavage site in the first transmembrane domain, and a leucine-rich region that overlaps the first 4 transmemb
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Transmembrane protein 173 (TMEM173) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Transmembrane protein 173 (TMEM173) |
KTE70180-96T |
Abbkine |
96T |
EUR 539 |
- The deduced 379-amino acid protein has a calculated molecular mass of 42.2 kD. It has 5 putative N-terminal transmembrane domains, a signal cleavage site in the first transmembrane domain, and a leucine-rich region that overlaps the first 4 transmemb
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Transmembrane protein 173 (TMEM173) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Transmembrane Protein 173 (TMEM173) Polyclonal Antibody (Mouse) |
4-PAN011Mu01 |
Cloud-Clone |
-
EUR 266.00
-
EUR 2813.00
-
EUR 694.00
-
EUR 337.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TMEM173 (Trp160~Leu371)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Transmembrane Protein 173 (TMEM173) |
Transmembrane Protein 173 (TMEM173) Polyclonal Antibody (Rat) |
4-PAN011Ra01 |
Cloud-Clone |
-
EUR 275.00
-
EUR 2958.00
-
EUR 727.00
-
EUR 350.00
-
EUR 226.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TMEM173 (Ala160~Leu363)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Transmembrane Protein 173 (TMEM173) |
Transmembrane Protein 173 (TMEM173) Polyclonal Antibody (Human, Mouse) |
4-PAN011Hu01 |
Cloud-Clone |
-
EUR 261.00
-
EUR 2734.00
-
EUR 676.00
-
EUR 330.00
-
EUR 220.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TMEM173 (Leu159~Pro373)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Transmembrane Protein 173 (TMEM173) |
Transmembrane Protein 173 (TMEM173) Polyclonal Antibody (Mouse), APC |
4-PAN011Mu01-APC |
Cloud-Clone |
-
EUR 374.00
-
EUR 3689.00
-
EUR 1016.00
-
EUR 481.00
-
EUR 232.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TMEM173 (Trp160~Leu371)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Transmembrane Protein 173 (TMEM173). This antibody is labeled with APC. |
Transmembrane Protein 173 (TMEM173) Polyclonal Antibody (Mouse), Biotinylated |
4-PAN011Mu01-Biotin |
Cloud-Clone |
-
EUR 332.00
-
EUR 2763.00
-
EUR 803.00
-
EUR 411.00
-
EUR 228.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TMEM173 (Trp160~Leu371)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Transmembrane Protein 173 (TMEM173). This antibody is labeled with Biotin. |
Transmembrane Protein 173 (TMEM173) Polyclonal Antibody (Mouse), Cy3 |
4-PAN011Mu01-Cy3 |
Cloud-Clone |
-
EUR 457.00
-
EUR 4877.00
-
EUR 1313.00
-
EUR 600.00
-
EUR 267.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TMEM173 (Trp160~Leu371)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Transmembrane Protein 173 (TMEM173). This antibody is labeled with Cy3. |
Transmembrane Protein 173 (TMEM173) Polyclonal Antibody (Mouse), FITC |
4-PAN011Mu01-FITC |
Cloud-Clone |
-
EUR 319.00
-
EUR 2971.00
-
EUR 832.00
-
EUR 405.00
-
EUR 205.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TMEM173 (Trp160~Leu371)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Transmembrane Protein 173 (TMEM173). This antibody is labeled with FITC. |
Transmembrane Protein 173 (TMEM173) Polyclonal Antibody (Mouse), HRP |
4-PAN011Mu01-HRP |
Cloud-Clone |
-
EUR 341.00
-
EUR 3213.00
-
EUR 897.00
-
EUR 433.00
-
EUR 217.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TMEM173 (Trp160~Leu371)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Transmembrane Protein 173 (TMEM173). This antibody is labeled with HRP. |
Transmembrane Protein 173 (TMEM173) Polyclonal Antibody (Mouse), PE |
4-PAN011Mu01-PE |
Cloud-Clone |
-
EUR 319.00
-
EUR 2971.00
-
EUR 832.00
-
EUR 405.00
-
EUR 205.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TMEM173 (Trp160~Leu371)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Transmembrane Protein 173 (TMEM173). This antibody is labeled with PE. |
Transmembrane Protein 173 (TMEM173) Polyclonal Antibody (Rat), APC |
4-PAN011Ra01-APC |
Cloud-Clone |
-
EUR 388.00
-
EUR 3887.00
-
EUR 1065.00
-
EUR 501.00
-
EUR 237.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TMEM173 (Ala160~Leu363)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Transmembrane Protein 173 (TMEM173). This antibody is labeled with APC. |
Transmembrane Protein 173 (TMEM173) Polyclonal Antibody (Rat), Biotinylated |
4-PAN011Ra01-Biotin |
Cloud-Clone |
-
EUR 343.00
-
EUR 2908.00
-
EUR 839.00
-
EUR 425.00
-
EUR 232.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TMEM173 (Ala160~Leu363)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Transmembrane Protein 173 (TMEM173). This antibody is labeled with Biotin. |
Transmembrane Protein 173 (TMEM173) Polyclonal Antibody (Rat), Cy3 |
4-PAN011Ra01-Cy3 |
Cloud-Clone |
-
EUR 476.00
-
EUR 5141.00
-
EUR 1379.00
-
EUR 626.00
-
EUR 275.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TMEM173 (Ala160~Leu363)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Transmembrane Protein 173 (TMEM173). This antibody is labeled with Cy3. |
Transmembrane Protein 173 (TMEM173) Polyclonal Antibody (Rat), FITC |
4-PAN011Ra01-FITC |
Cloud-Clone |
-
EUR 330.00
-
EUR 3129.00
-
EUR 872.00
-
EUR 420.00
-
EUR 210.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TMEM173 (Ala160~Leu363)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Transmembrane Protein 173 (TMEM173). This antibody is labeled with FITC. |
Transmembrane Protein 173 (TMEM173) Polyclonal Antibody (Rat), HRP |
4-PAN011Ra01-HRP |
Cloud-Clone |
-
EUR 353.00
-
EUR 3385.00
-
EUR 940.00
-
EUR 451.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TMEM173 (Ala160~Leu363)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Transmembrane Protein 173 (TMEM173). This antibody is labeled with HRP. |
Transmembrane Protein 173 (TMEM173) Polyclonal Antibody (Rat), PE |
4-PAN011Ra01-PE |
Cloud-Clone |
-
EUR 330.00
-
EUR 3129.00
-
EUR 872.00
-
EUR 420.00
-
EUR 210.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TMEM173 (Ala160~Leu363)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Transmembrane Protein 173 (TMEM173). This antibody is labeled with PE. |
Transmembrane Protein 173 (TMEM173) Polyclonal Antibody (Human, Mouse), APC |
4-PAN011Hu01-APC |
Cloud-Clone |
-
EUR 367.00
-
EUR 3581.00
-
EUR 989.00
-
EUR 470.00
-
EUR 228.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TMEM173 (Leu159~Pro373)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Transmembrane Protein 173 (TMEM173). This antibody is labeled with APC. |
Transmembrane Protein 173 (TMEM173) Polyclonal Antibody (Human, Mouse), Biotinylated |
4-PAN011Hu01-Biotin |
Cloud-Clone |
-
EUR 327.00
-
EUR 2684.00
-
EUR 783.00
-
EUR 403.00
-
EUR 225.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TMEM173 (Leu159~Pro373)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Transmembrane Protein 173 (TMEM173). This antibody is labeled with Biotin. |
Transmembrane Protein 173 (TMEM173) Polyclonal Antibody (Human, Mouse), Cy3 |
4-PAN011Hu01-Cy3 |
Cloud-Clone |
-
EUR 447.00
-
EUR 4733.00
-
EUR 1277.00
-
EUR 585.00
-
EUR 263.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TMEM173 (Leu159~Pro373)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Transmembrane Protein 173 (TMEM173). This antibody is labeled with Cy3. |
Transmembrane Protein 173 (TMEM173) Polyclonal Antibody (Human, Mouse), FITC |
4-PAN011Hu01-FITC |
Cloud-Clone |
-
EUR 313.00
-
EUR 2884.00
-
EUR 811.00
-
EUR 396.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TMEM173 (Leu159~Pro373)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Transmembrane Protein 173 (TMEM173). This antibody is labeled with FITC. |
Transmembrane Protein 173 (TMEM173) Polyclonal Antibody (Human, Mouse), HRP |
4-PAN011Hu01-HRP |
Cloud-Clone |
-
EUR 334.00
-
EUR 3120.00
-
EUR 873.00
-
EUR 424.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TMEM173 (Leu159~Pro373)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Transmembrane Protein 173 (TMEM173). This antibody is labeled with HRP. |
Transmembrane Protein 173 (TMEM173) Polyclonal Antibody (Human, Mouse), PE |
4-PAN011Hu01-PE |
Cloud-Clone |
-
EUR 313.00
-
EUR 2884.00
-
EUR 811.00
-
EUR 396.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TMEM173 (Leu159~Pro373)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Transmembrane Protein 173 (TMEM173). This antibody is labeled with PE. |
Transmembrane Protein 173 (TMEM173) Polyclonal Antibody (Mouse), APC-Cy7 |
4-PAN011Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 628.00
-
EUR 7258.00
-
EUR 1912.00
-
EUR 842.00
-
EUR 344.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TMEM173 (Trp160~Leu371)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Transmembrane Protein 173 (TMEM173). This antibody is labeled with APC-Cy7. |
Transmembrane Protein 173 (TMEM173) Polyclonal Antibody (Rat), APC-Cy7 |
4-PAN011Ra01-APC-Cy7 |
Cloud-Clone |
-
EUR 657.00
-
EUR 7654.00
-
EUR 2011.00
-
EUR 882.00
-
EUR 355.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TMEM173 (Ala160~Leu363)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Transmembrane Protein 173 (TMEM173). This antibody is labeled with APC-Cy7. |
Transmembrane Protein 173 (TMEM173) Polyclonal Antibody (Human, Mouse), APC-Cy7 |
4-PAN011Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 614.00
-
EUR 7042.00
-
EUR 1858.00
-
EUR 821.00
-
EUR 337.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TMEM173 (Leu159~Pro373)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Transmembrane Protein 173 (TMEM173). This antibody is labeled with APC-Cy7. |
Transmembrane Protein 173 (TM173) Antibody |
abx034495-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Transmembrane Protein 173 (TM173) Antibody |
abx034495-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Transmembrane Protein 173 (TM173) Antibody |
abx034525-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Transmembrane Protein 173 (TM173) Antibody |
abx034525-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
TMEM173 ELISA Kit (Human) (OKCD00623) |
OKCD00623 |
Aviva Systems Biology |
96 Wells |
EUR 909 |
Description: Description of target: This gene encodes a five transmembrane protein that functions as a major regulator of the innate immune response to viral and bacterial infections. The encoded protein is a pattern recognition receptor that detects cytosolic nucleic acids and transmits signals that activate type I interferon responses. The encoded protein has also been shown to play a role in apoptotic signaling by associating with type II major histocompatibility complex. Mutations in this gene are the cause of infantile-onset STING-associated vasculopathy. Alternate splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.055 ng/mL |
TMEM173 Recombinant Protein (Human) |
RP032008 |
ABM |
100 ug |
Ask for price |
TMEM173 ELISA Kit (Chicken) (OKCA02019) |
OKCA02019 |
Aviva Systems Biology |
96 Wells |
EUR 917 |
Description: Description of target: Facilitator of innate immune signaling that acts as a sensor of cytosolic DNA from bacteria and viruses and promotes the production of type I interferon (IFN-alpha and IFN-beta). Innate immune response is triggered in response to non-CpG double-stranded DNA from viruses and bacteria delivered to the cytoplasm. Acts by recognizing and binding cyclic di-GMP (c-di-GMP), a second messenger produced by bacteria, and cyclic GMP-AMP (cGAMP), a messenger produced in response to DNA virus in the cytosol: upon binding of c-di-GMP or cGAMP, autoinhibition is alleviated and TMEM173/STING is able to activate both NF-kappa-B and IRF3 transcription pathways to induce expression of type I interferon and exert a potent anti-viral state.;Species reactivity: Chicken;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 7.8 pg/mL |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
TMEM173 siRNA |
20-abx937153 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TMEM173 siRNA |
20-abx937154 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TMEM173 antibody |
70R-20869 |
Fitzgerald |
50 ug |
EUR 435 |
Description: Rabbit polyclonal TMEM173 antibody |
TMEM173 antibody |
70R-2359 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal TMEM173 antibody raised against the middle region of TMEM173 |
TMEM173 Antibody |
49658-100ul |
SAB |
100ul |
EUR 333 |
TMEM173 Antibody |
49658-50ul |
SAB |
50ul |
EUR 239 |
TMEM173 Antibody |
1-CSB-PA005903 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against TMEM173. Recognizes TMEM173 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000 |
TMEM173 Antibody |
1-CSB-PA023754GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against TMEM173. Recognizes TMEM173 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF, FC |
TMEM173 Antibody |
1-CSB-PA023754LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TMEM173. Recognizes TMEM173 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:200-1:500, IF:1:50-1:200 |
APF LB Broth Miller |
173 |
AthenaES |
500 ml |
EUR 68 |
TMEM173 Recombinant Protein (Mouse) |
RP179423 |
ABM |
100 ug |
Ask for price |
Human Transmembrane protein 119 ELISA kit |
E01T0877-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Transmembrane protein 119 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 119 ELISA kit |
E01T0877-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Transmembrane protein 119 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 119 ELISA kit |
E01T0877-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Transmembrane protein 119 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human TMEM173 shRNA Plasmid |
20-abx967322 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Recombinant Human C1QTNF6 Protein-6His-ABP tag |
CTP-173 |
Creative Biolabs |
100ug |
Ask for price |
Description: A 32 kDa recombinant human C1QTNF6 protein Antigen with a GST-tag at N-terminal expressed in E. Coli. |
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit |
CAS400A-KIT |
SBI |
1 kit (10 rxn) |
EUR 1110 |
|
HS-173 |
B4492-25 |
ApexBio |
25 mg |
EUR 325 |
Description: Phosphatidylinositol 3-kinase (PI3K) was first identified over 20 years ago as a lipid kinase associated with viral oncoproteins. |
HS-173 |
B4492-5 |
ApexBio |
5 mg |
EUR 128 |
Description: Phosphatidylinositol 3-kinase (PI3K) was first identified over 20 years ago as a lipid kinase associated with viral oncoproteins. |
HS-173 |
B4492-5.1 |
ApexBio |
10 mM (in 1mL DMSO) |
EUR 154 |
Description: Phosphatidylinositol 3-kinase (PI3K) was first identified over 20 years ago as a lipid kinase associated with viral oncoproteins. |
Human Probable G- protein coupled receptor 173, GPR173 ELISA KIT |
ELI-27266h |
Lifescience Market |
96 Tests |
EUR 824 |
TMEM173 Conjugated Antibody |
C49658 |
SAB |
100ul |
EUR 397 |
TMEM173 cloning plasmid |
CSB-CL023754HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1140
- Sequence: atgccccactccagcctgcatccatccatcccgtgtcccaggggtcacggggcccagaaggcagccttggttctgctgagtgcctgcctggtgaccctttgggggctaggagagccaccagagcacactctccggtacctggtgctccacctagcctccctgcagctgggactgc
- Show more
|
Description: A cloning plasmid for the TMEM173 gene. |
TMEM173 Polyclonal Antibody |
ES4218-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against TMEM173 from Human/Mouse. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
TMEM173 Polyclonal Antibody |
ES4218-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against TMEM173 from Human/Mouse. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
anti- TMEM173 antibody |
FNab08759 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:50 - 1:100
- Immunogen: transmembrane protein 173
- Uniprot ID: Q86WV6
- Gene ID: 340061
- Research Area: Cancer, Immunology, Epigenetics
|
Description: Antibody raised against TMEM173 |
TMEM173 Polyclonal Antibody |
ABP53219-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from the C-terminal region of human TMEM173
- Applications tips:
|
Description: A polyclonal antibody for detection of TMEM173 from Human, Mouse. This TMEM173 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human TMEM173 |
TMEM173 Polyclonal Antibody |
ABP53219-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from the C-terminal region of human TMEM173
- Applications tips:
|
Description: A polyclonal antibody for detection of TMEM173 from Human, Mouse. This TMEM173 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human TMEM173 |
TMEM173 Polyclonal Antibody |
ABP53219-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from the C-terminal region of human TMEM173
- Applications tips:
|
Description: A polyclonal antibody for detection of TMEM173 from Human, Mouse. This TMEM173 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human TMEM173 |
TMEM173 Blocking Peptide |
33R-2109 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TMEM173 antibody, catalog no. 70R-2359 |
TMEM173 Polyclonal Antibody |
41859-100ul |
SAB |
100ul |
EUR 252 |
TMEM173 Polyclonal Antibody |
41859-50ul |
SAB |
50ul |
EUR 187 |
TMEM173/STING Antibody |
DF12090 |
Affbiotech |
200ul |
EUR 304 |
Description: TMEM173/STING antibody detects endogenous levels of TMEM173/STING. |
Anti-TMEM173 Antibody |
PB9513 |
BosterBio |
100ug/vial |
EUR 334 |
Anti-TMEM173 antibody |
STJ96853 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to TMEM173. |
Anti-TMEM173 antibody |
STJ25875 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a five transmembrane protein that functions as a major regulator of the innate immune response to viral and bacterial infections. The encoded protein is a pattern recognition receptor that detects cytosolic nucleic acids and transmits signals that activate type I interferon responses. The encoded protein has also been shown to play a role in apoptotic signaling by associating with type II major histocompatibility complex. Mutations in this gene are the cause of infantile-onset STING-associated vasculopathy. Alternate splicing results in multiple transcript variants. |
Anti-TMEM173 antibody |
STJ111179 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a five transmembrane protein that functions as a major regulator of the innate immune response to viral and bacterial infections. The encoded protein is a pattern recognition receptor that detects cytosolic nucleic acids and transmits signals that activate type I interferon responses. The encoded protein has also been shown to play a role in apoptotic signaling by associating with type II major histocompatibility complex. Mutations in this gene are the cause of infantile-onset STING-associated vasculopathy. Alternate splicing results in multiple transcript variants. |
Human Transmembrane protein 104(TMEM104) ELISA kit |
E01T0699-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 104(TMEM104) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 104(TMEM104) ELISA kit |
E01T0699-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 104(TMEM104) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 104(TMEM104) ELISA kit |
E01T0699-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 104(TMEM104) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 121(TMEM121) ELISA kit |
E01T0701-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 121(TMEM121) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 121(TMEM121) ELISA kit |
E01T0701-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 121(TMEM121) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 121(TMEM121) ELISA kit |
E01T0701-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 121(TMEM121) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 129(TMEM129) ELISA kit |
E01T0702-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 129(TMEM129) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 129(TMEM129) ELISA kit |
E01T0702-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 129(TMEM129) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 129(TMEM129) ELISA kit |
E01T0702-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 129(TMEM129) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 170A(TMEM170A) ELISA kit |
E01T0703-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 170A(TMEM170A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 170A(TMEM170A) ELISA kit |
E01T0703-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 170A(TMEM170A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 170A(TMEM170A) ELISA kit |
E01T0703-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 170A(TMEM170A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 175(TMEM175) ELISA kit |
E01T0705-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 175(TMEM175) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 175(TMEM175) ELISA kit |
E01T0705-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 175(TMEM175) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 175(TMEM175) ELISA kit |
E01T0705-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 175(TMEM175) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 18(TMEM18) ELISA kit |
E01T0706-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 18(TMEM18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 18(TMEM18) ELISA kit |
E01T0706-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 18(TMEM18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 18(TMEM18) ELISA kit |
E01T0706-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 18(TMEM18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 180(TMEM180) ELISA kit |
E01T0707-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 180(TMEM180) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 180(TMEM180) ELISA kit |
E01T0707-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 180(TMEM180) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 180(TMEM180) ELISA kit |
E01T0707-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 180(TMEM180) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 184C(TMEM184C) ELISA kit |
E01T0708-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 184C(TMEM184C) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 184C(TMEM184C) ELISA kit |
E01T0708-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 184C(TMEM184C) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 184C(TMEM184C) ELISA kit |
E01T0708-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 184C(TMEM184C) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 194B(TMEM194B) ELISA kit |
E01T0709-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 194B(TMEM194B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 194B(TMEM194B) ELISA kit |
E01T0709-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 194B(TMEM194B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 194B(TMEM194B) ELISA kit |
E01T0709-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 194B(TMEM194B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 208(TMEM208) ELISA kit |
E01T0710-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 208(TMEM208) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 208(TMEM208) ELISA kit |
E01T0710-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 208(TMEM208) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 208(TMEM208) ELISA kit |
E01T0710-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 208(TMEM208) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 22(TMEM22) ELISA kit |
E01T0711-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 22(TMEM22) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 22(TMEM22) ELISA kit |
E01T0711-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 22(TMEM22) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 22(TMEM22) ELISA kit |
E01T0711-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 22(TMEM22) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 41B(TMEM41B) ELISA kit |
E01T0713-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 41B(TMEM41B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 41B(TMEM41B) ELISA kit |
E01T0713-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 41B(TMEM41B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 41B(TMEM41B) ELISA kit |
E01T0713-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 41B(TMEM41B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 68(TMEM68) ELISA kit |
E01T0714-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 68(TMEM68) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 68(TMEM68) ELISA kit |
E01T0714-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 68(TMEM68) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 68(TMEM68) ELISA kit |
E01T0714-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 68(TMEM68) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
ELISA kit for Human Transmembrane protein 158 |
EK2693 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Transmembrane protein 158 in samples from serum, plasma, tissue homogenates and other biological fluids. |
ELISA kit for Human Transmembrane protein 132D |
EK4617 |
SAB |
96 tests |
EUR 603 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Transmembrane protein 132D in samples from serum, plasma, tissue homogenates and other biological fluids. |
ELISA kit for Human Transmembrane protein 126A |
EK4626 |
SAB |
96 tests |
EUR 603 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Transmembrane protein 126A in samples from serum, plasma, tissue homogenates and other biological fluids. |
Human TMEM127(Transmembrane protein 127) ELISA Kit |
EH4117 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 78-5000 pg/ml
- Uniprot ID: O75204
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml |
Human TMEM126A/ Transmembrane protein 126A ELISA Kit |
E2519Hu |
Sunlong |
1 Kit |
EUR 605 |
Human TMEM132D/ Transmembrane protein 132D ELISA Kit |
E2520Hu |
Sunlong |
1 Kit |
EUR 605 |
Human TMEM158/ Transmembrane protein 158 ELISA Kit |
E2521Hu |
Sunlong |
1 Kit |
EUR 571 |
Human TMEM158(Transmembrane protein 158) ELISA Kit |
EH1212 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: Q8WZ71
- Alias: TMEM158/Transmembrane protein 158/40 kDa BINP-binding protein/p40BBP/Ras-induced senescence protein 1
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
Human TMEM132D(Transmembrane protein 132D) ELISA Kit |
EH2284 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: Q14C87
- Alias: TMEM132D/Transmembrane protein 132D/Mature oligodendrocytes transmembrane protein(Mature OL transmembrane protein)
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
Human TMEM126A(Transmembrane protein 126A) ELISA Kit |
EH2289 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: Q9H061
- Alias: TMEM126A
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
Human Transmembrane protein C20orf46, C20orf46 ELISA KIT |
ELI-10133h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein C9orf71, C9orf71 ELISA KIT |
ELI-10273h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein C9orf91, C9orf91 ELISA KIT |
ELI-10653h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein C9orf123, C9orf123 ELISA KIT |
ELI-10970h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein C9orf125, C9orf125 ELISA KIT |
ELI-10971h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 106B, TMEM106B ELISA KIT |
ELI-13690h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 183B, TMEM183B ELISA KIT |
ELI-13712h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 229B, TMEM229B ELISA KIT |
ELI-18570h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 132E, TMEM132E ELISA KIT |
ELI-18753h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 150B, TMEM150B ELISA KIT |
ELI-18754h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 194B, TMEM194B ELISA KIT |
ELI-18755h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 104, TMEM104 ELISA KIT |
ELI-22923h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 110, TMEM110 ELISA KIT |
ELI-22925h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 143, TMEM143 ELISA KIT |
ELI-22927h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 205, TMEM205 ELISA KIT |
ELI-22933h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 39B, TMEM39B ELISA KIT |
ELI-22937h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 26, TMEM26 ELISA KIT |
ELI-22980h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 80, TMEM80 ELISA KIT |
ELI-22984h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 132A, TMEM132A ELISA KIT |
ELI-23553h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein C2orf18, C2orf18 ELISA KIT |
ELI-24968h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein C1orf70, C1orf70 ELISA KIT |
ELI-25022h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein C9orf46, C9orf46 ELISA KIT |
ELI-25290h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein C9orf5, C9orf5 ELISA KIT |
ELI-25647h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein C10orf57, C10orf57 ELISA KIT |
ELI-25797h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein C7orf23, C7orf23 ELISA KIT |
ELI-25903h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein C18orf45, C18orf45 ELISA KIT |
ELI-26110h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein C16orf54, C16orf54 ELISA KIT |
ELI-26166h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 158, TMEM158 ELISA KIT |
ELI-03517h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 206, TMEM206 ELISA KIT |
ELI-16076h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 213, TMEM213 ELISA KIT |
ELI-16078h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 214, TMEM214 ELISA KIT |
ELI-16079h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 235, TMEM235 ELISA KIT |
ELI-16080h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 50B, TMEM50B ELISA KIT |
ELI-16083h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 88B, TMEM88B ELISA KIT |
ELI-16086h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 9, TMEM9 ELISA KIT |
ELI-16307h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 25, TMEM25 ELISA KIT |
ELI-16310h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 52, TMEM52 ELISA KIT |
ELI-16312h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 60, TMEM60 ELISA KIT |
ELI-16314h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 111, TMEM111 ELISA KIT |
ELI-17099h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 139, TMEM139 ELISA KIT |
ELI-17102h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 154, TMEM154 ELISA KIT |
ELI-17104h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 204, TMEM204 ELISA KIT |
ELI-17111h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 50A, TMEM50A ELISA KIT |
ELI-17117h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 53, TMEM53 ELISA KIT |
ELI-17124h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 72, TMEM72 ELISA KIT |
ELI-17128h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 82, TMEM82 ELISA KIT |
ELI-17130h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 92, TMEM92 ELISA KIT |
ELI-17132h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 42, TMEM42 ELISA KIT |
ELI-17216h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 68, TMEM68 ELISA KIT |
ELI-17218h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 9B, TMEM9B ELISA KIT |
ELI-17219h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 87A, TMEM87A ELISA KIT |
ELI-17246h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 43, TMEM43 ELISA KIT |
ELI-17261h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 71, TMEM71 ELISA KIT |
ELI-17265h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 78, TMEM78 ELISA KIT |
ELI-17266h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 97, TMEM97 ELISA KIT |
ELI-17270h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 14D, TMEM14D ELISA KIT |
ELI-17327h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 165, TMEM165 ELISA KIT |
ELI-17328h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 171, TMEM171 ELISA KIT |
ELI-17331h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 198, TMEM198 ELISA KIT |
ELI-17334h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 199, TMEM199 ELISA KIT |
ELI-17335h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 234, TMEM234 ELISA KIT |
ELI-17340h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 136, TMEM136 ELISA KIT |
ELI-17348h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 14A, TMEM14A ELISA KIT |
ELI-17351h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 187, TMEM187 ELISA KIT |
ELI-17356h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 220, TMEM220 ELISA KIT |
ELI-17361h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 45B, TMEM45B ELISA KIT |
ELI-17365h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein C17orf87, C17orf87 ELISA KIT |
ELI-09071h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 222, TMEM222 ELISA KIT |
ELI-28228h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 41A, TMEM41A ELISA KIT |
ELI-28229h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 63B, TMEM63B ELISA KIT |
ELI-28232h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 19, TMEM19 ELISA KIT |
ELI-51820h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 115, TMEM115 ELISA KIT |
ELI-51903h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 125, TMEM125 ELISA KIT |
ELI-51904h |
Lifescience Market |
96 Tests |
EUR 824 |
Human TMEM173(Transmembrane Protein 173) ELISA Kit