Human TMEM173(Transmembrane Protein 173) ELISA Kit

Human TMEM173(Transmembrane Protein 173) ELISA Kit

To Order Contact us: [email protected]

Human Transmembrane Protein 173 (TMEM173) ELISA Kit

20-abx258669
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Transmembrane Protein 173 (TMEM173) ELISA Kit

SEN011Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transmembrane Protein 173 (TMEM173) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transmembrane Protein 173 (TMEM173) in Tissue homogenates, cell lysates and other biological fluids.

Human Transmembrane Protein 173 (TMEM173) ELISA Kit

SEN011Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transmembrane Protein 173 (TMEM173) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transmembrane Protein 173 (TMEM173) in Tissue homogenates, cell lysates and other biological fluids.

Human Transmembrane Protein 173 (TMEM173) ELISA Kit

SEN011Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transmembrane Protein 173 (TMEM173) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transmembrane Protein 173 (TMEM173) in Tissue homogenates, cell lysates and other biological fluids.

Human Transmembrane Protein 173 (TMEM173) ELISA Kit

SEN011Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transmembrane Protein 173 (TMEM173) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transmembrane Protein 173 (TMEM173) in Tissue homogenates, cell lysates and other biological fluids.

Human Transmembrane Protein 173 (TMEM173) ELISA Kit

4-SEN011Hu
  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Transmembrane Protein 173 elisa. Alternative names of the recognized antigen: NET23
  • ERIS
  • MPYS
  • MITA
  • STING
  • Endoplasmic Reticulum Interferon Stimulator
  • Stimulator Of Interferon Genes Protein
  • Mediator of IRF3 activation
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Transmembrane Protein 173 (TMEM173) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Transmembrane Protein 173 (TMEM173) Protein

20-abx069447
  • EUR 648.00
  • EUR 272.00
  • EUR 1943.00
  • EUR 759.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Transmembrane Protein 173 (TMEM173) Antibody

20-abx116240
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Transmembrane Protein 173 (TMEM173) Antibody

20-abx129806
  • EUR 467.00
  • EUR 133.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Transmembrane Protein 173 (TMEM173) Antibody

20-abx102945
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Transmembrane Protein 173 (TMEM173) Antibody

20-abx102946
  • EUR 481.00
  • EUR 133.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Transmembrane Protein 173 (TMEM173) Antibody

20-abx325479
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Recombinant Transmembrane Protein 173 (TMEM173)

4-RPN011Hu01
  • EUR 458.40
  • EUR 226.00
  • EUR 1444.00
  • EUR 548.00
  • EUR 996.00
  • EUR 370.00
  • EUR 3460.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q86WV6
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 28.2kDa
  • Isoelectric Point: 5.8
Description: Recombinant Human Transmembrane Protein 173 expressed in: E.coli

Recombinant Transmembrane Protein 173 (TMEM173)

4-RPN011Mu01
  • EUR 485.28
  • EUR 233.00
  • EUR 1544.80
  • EUR 581.60
  • EUR 1063.20
  • EUR 388.00
  • EUR 3712.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q3TBT3
  • Buffer composition: 100mMNaHCO3, 500mMNaCl, pH8.3, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 27.8kDa
  • Isoelectric Point: 5.2
Description: Recombinant Mouse Transmembrane Protein 173 expressed in: E.coli

Recombinant Transmembrane Protein 173 (TMEM173)

4-RPN011Ra01
  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: F1M391
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 26.9kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Transmembrane Protein 173 expressed in: E.coli

Mouse Transmembrane protein 173(TMEM173) ELISA kit

E03T0704-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Transmembrane protein 173(TMEM173) ELISA kit

E03T0704-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Transmembrane protein 173(TMEM173) ELISA kit

E03T0704-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Transmembrane protein 173(TMEM173) ELISA kit

E02T0704-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Transmembrane protein 173(TMEM173) ELISA kit

E02T0704-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Transmembrane protein 173(TMEM173) ELISA kit

E02T0704-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Transmembrane protein 173(TMEM173) ELISA kit

E04T0704-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Transmembrane protein 173(TMEM173) ELISA kit

E04T0704-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Transmembrane protein 173(TMEM173) ELISA kit

E04T0704-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Transmembrane protein 173(TMEM173) ELISA kit

E08T0704-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Transmembrane protein 173(TMEM173) ELISA kit

E08T0704-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Transmembrane protein 173(TMEM173) ELISA kit

E08T0704-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Transmembrane protein 173(TMEM173) ELISA kit

E07T0704-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Transmembrane protein 173(TMEM173) ELISA kit

E07T0704-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Transmembrane protein 173(TMEM173) ELISA kit

E07T0704-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Transmembrane protein 173(TMEM173) ELISA kit

E06T0704-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Transmembrane protein 173(TMEM173) ELISA kit

E06T0704-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Transmembrane protein 173(TMEM173) ELISA kit

E06T0704-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Transmembrane protein 173(TMEM173) ELISA kit

E09T0704-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Transmembrane protein 173(TMEM173) ELISA kit

E09T0704-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Transmembrane protein 173(TMEM173) ELISA kit

E09T0704-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Chicken Transmembrane protein 173, TMEM173 ELISA KIT

ELI-17107c 96 Tests
EUR 928

Mouse Transmembrane protein 173, Tmem173 ELISA KIT

ELI-37526m 96 Tests
EUR 865

Porcine Transmembrane protein 173, TMEM173 ELISA KIT

ELI-39868p 96 Tests
EUR 928

Bovine Transmembrane protein 173, TMEM173 ELISA KIT

ELI-41973b 96 Tests
EUR 928

Human Transmembrane Protein 173 (TMEM173) CLIA Kit

20-abx496082
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human TMEM173 (Transmembrane Protein 173)

ELK7591 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Transmembrane Protein 173 (TMEM173). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific t
  • Show more
Description: A sandwich ELISA kit for detection of Transmembrane Protein 173 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Transmembrane protein 173 (TMEM173)

KTE60282-48T 48T
EUR 332
  • The deduced 379-amino acid protein has a calculated molecular mass of 42.2 kD. It has 5 putative N-terminal transmembrane domains, a signal cleavage site in the first transmembrane domain, and a leucine-rich region that overlaps the first 4 transmemb
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Transmembrane protein 173 (TMEM173) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Transmembrane protein 173 (TMEM173)

KTE60282-5platesof96wells 5 plates of 96 wells
EUR 2115
  • The deduced 379-amino acid protein has a calculated molecular mass of 42.2 kD. It has 5 putative N-terminal transmembrane domains, a signal cleavage site in the first transmembrane domain, and a leucine-rich region that overlaps the first 4 transmemb
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Transmembrane protein 173 (TMEM173) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Transmembrane protein 173 (TMEM173)

KTE60282-96T 96T
EUR 539
  • The deduced 379-amino acid protein has a calculated molecular mass of 42.2 kD. It has 5 putative N-terminal transmembrane domains, a signal cleavage site in the first transmembrane domain, and a leucine-rich region that overlaps the first 4 transmemb
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Transmembrane protein 173 (TMEM173) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Rat Transmembrane Protein 173 (TMEM173) Protein

20-abx069448
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Transmembrane Protein 173 (TMEM173) Protein

20-abx165931
  • EUR 676.00
  • EUR 286.00
  • EUR 2082.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Transmembrane Protein 173 (TMEM173) Antibody (FITC)

20-abx274261
  • EUR 509.00
  • EUR 258.00
  • EUR 1539.00
  • EUR 718.00
  • EUR 411.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Guinea pig Transmembrane protein 173(TMEM173) ELISA kit

E05T0704-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Transmembrane protein 173(TMEM173) ELISA kit

E05T0704-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Transmembrane protein 173(TMEM173) ELISA kit

E05T0704-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Pig Transmembrane protein 173 (TMEM173)

KTE80020-48T 48T
EUR 354
  • The deduced 379-amino acid protein has a calculated molecular mass of 42.2 kD. It has 5 putative N-terminal transmembrane domains, a signal cleavage site in the first transmembrane domain, and a leucine-rich region that overlaps the first 4 transmemb
  • Show more
Description: Quantitative sandwich ELISA for measuring Pig Transmembrane protein 173 (TMEM173) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Pig Transmembrane protein 173 (TMEM173)

KTE80020-5platesof96wells 5 plates of 96 wells
EUR 2252
  • The deduced 379-amino acid protein has a calculated molecular mass of 42.2 kD. It has 5 putative N-terminal transmembrane domains, a signal cleavage site in the first transmembrane domain, and a leucine-rich region that overlaps the first 4 transmemb
  • Show more
Description: Quantitative sandwich ELISA for measuring Pig Transmembrane protein 173 (TMEM173) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Pig Transmembrane protein 173 (TMEM173)

KTE80020-96T 96T
EUR 572
  • The deduced 379-amino acid protein has a calculated molecular mass of 42.2 kD. It has 5 putative N-terminal transmembrane domains, a signal cleavage site in the first transmembrane domain, and a leucine-rich region that overlaps the first 4 transmemb
  • Show more
Description: Quantitative sandwich ELISA for measuring Pig Transmembrane protein 173 (TMEM173) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Transmembrane protein 173 (TMEM173)

KTE10047-48T 48T
EUR 354
  • The deduced 379-amino acid protein has a calculated molecular mass of 42.2 kD. It has 5 putative N-terminal transmembrane domains, a signal cleavage site in the first transmembrane domain, and a leucine-rich region that overlaps the first 4 transmemb
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Transmembrane protein 173 (TMEM173) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Transmembrane protein 173 (TMEM173)

KTE10047-5platesof96wells 5 plates of 96 wells
EUR 2252
  • The deduced 379-amino acid protein has a calculated molecular mass of 42.2 kD. It has 5 putative N-terminal transmembrane domains, a signal cleavage site in the first transmembrane domain, and a leucine-rich region that overlaps the first 4 transmemb
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Transmembrane protein 173 (TMEM173) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Transmembrane protein 173 (TMEM173)

KTE10047-96T 96T
EUR 572
  • The deduced 379-amino acid protein has a calculated molecular mass of 42.2 kD. It has 5 putative N-terminal transmembrane domains, a signal cleavage site in the first transmembrane domain, and a leucine-rich region that overlaps the first 4 transmemb
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Transmembrane protein 173 (TMEM173) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Chicken Transmembrane protein 173 (TMEM173)

KTE30016-48T 48T
EUR 354
  • The deduced 379-amino acid protein has a calculated molecular mass of 42.2 kD. It has 5 putative N-terminal transmembrane domains, a signal cleavage site in the first transmembrane domain, and a leucine-rich region that overlaps the first 4 transmemb
  • Show more
Description: Quantitative sandwich ELISA for measuring Chicken Transmembrane protein 173 (TMEM173) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Chicken Transmembrane protein 173 (TMEM173)

KTE30016-5platesof96wells 5 plates of 96 wells
EUR 2252
  • The deduced 379-amino acid protein has a calculated molecular mass of 42.2 kD. It has 5 putative N-terminal transmembrane domains, a signal cleavage site in the first transmembrane domain, and a leucine-rich region that overlaps the first 4 transmemb
  • Show more
Description: Quantitative sandwich ELISA for measuring Chicken Transmembrane protein 173 (TMEM173) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Chicken Transmembrane protein 173 (TMEM173)

KTE30016-96T 96T
EUR 572
  • The deduced 379-amino acid protein has a calculated molecular mass of 42.2 kD. It has 5 putative N-terminal transmembrane domains, a signal cleavage site in the first transmembrane domain, and a leucine-rich region that overlaps the first 4 transmemb
  • Show more
Description: Quantitative sandwich ELISA for measuring Chicken Transmembrane protein 173 (TMEM173) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Transmembrane protein 173 (TMEM173)

KTE70180-48T 48T
EUR 332
  • The deduced 379-amino acid protein has a calculated molecular mass of 42.2 kD. It has 5 putative N-terminal transmembrane domains, a signal cleavage site in the first transmembrane domain, and a leucine-rich region that overlaps the first 4 transmemb
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Transmembrane protein 173 (TMEM173) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Transmembrane protein 173 (TMEM173)

KTE70180-5platesof96wells 5 plates of 96 wells
EUR 2115
  • The deduced 379-amino acid protein has a calculated molecular mass of 42.2 kD. It has 5 putative N-terminal transmembrane domains, a signal cleavage site in the first transmembrane domain, and a leucine-rich region that overlaps the first 4 transmemb
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Transmembrane protein 173 (TMEM173) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Transmembrane protein 173 (TMEM173)

KTE70180-96T 96T
EUR 539
  • The deduced 379-amino acid protein has a calculated molecular mass of 42.2 kD. It has 5 putative N-terminal transmembrane domains, a signal cleavage site in the first transmembrane domain, and a leucine-rich region that overlaps the first 4 transmemb
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Transmembrane protein 173 (TMEM173) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Transmembrane Protein 173 (TMEM173) Polyclonal Antibody (Mouse)

4-PAN011Mu01
  • EUR 266.00
  • EUR 2813.00
  • EUR 694.00
  • EUR 337.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TMEM173 (Trp160~Leu371)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Transmembrane Protein 173 (TMEM173)

Transmembrane Protein 173 (TMEM173) Polyclonal Antibody (Rat)

4-PAN011Ra01
  • EUR 275.00
  • EUR 2958.00
  • EUR 727.00
  • EUR 350.00
  • EUR 226.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TMEM173 (Ala160~Leu363)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Transmembrane Protein 173 (TMEM173)

Transmembrane Protein 173 (TMEM173) Polyclonal Antibody (Human, Mouse)

4-PAN011Hu01
  • EUR 261.00
  • EUR 2734.00
  • EUR 676.00
  • EUR 330.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TMEM173 (Leu159~Pro373)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Transmembrane Protein 173 (TMEM173)

Transmembrane Protein 173 (TMEM173) Polyclonal Antibody (Mouse), APC

4-PAN011Mu01-APC
  • EUR 374.00
  • EUR 3689.00
  • EUR 1016.00
  • EUR 481.00
  • EUR 232.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TMEM173 (Trp160~Leu371)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Transmembrane Protein 173 (TMEM173). This antibody is labeled with APC.

Transmembrane Protein 173 (TMEM173) Polyclonal Antibody (Mouse), Biotinylated

4-PAN011Mu01-Biotin
  • EUR 332.00
  • EUR 2763.00
  • EUR 803.00
  • EUR 411.00
  • EUR 228.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TMEM173 (Trp160~Leu371)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Transmembrane Protein 173 (TMEM173). This antibody is labeled with Biotin.

Transmembrane Protein 173 (TMEM173) Polyclonal Antibody (Mouse), Cy3

4-PAN011Mu01-Cy3
  • EUR 457.00
  • EUR 4877.00
  • EUR 1313.00
  • EUR 600.00
  • EUR 267.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TMEM173 (Trp160~Leu371)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Transmembrane Protein 173 (TMEM173). This antibody is labeled with Cy3.

Transmembrane Protein 173 (TMEM173) Polyclonal Antibody (Mouse), FITC

4-PAN011Mu01-FITC
  • EUR 319.00
  • EUR 2971.00
  • EUR 832.00
  • EUR 405.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TMEM173 (Trp160~Leu371)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Transmembrane Protein 173 (TMEM173). This antibody is labeled with FITC.

Transmembrane Protein 173 (TMEM173) Polyclonal Antibody (Mouse), HRP

4-PAN011Mu01-HRP
  • EUR 341.00
  • EUR 3213.00
  • EUR 897.00
  • EUR 433.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TMEM173 (Trp160~Leu371)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Transmembrane Protein 173 (TMEM173). This antibody is labeled with HRP.

Transmembrane Protein 173 (TMEM173) Polyclonal Antibody (Mouse), PE

4-PAN011Mu01-PE
  • EUR 319.00
  • EUR 2971.00
  • EUR 832.00
  • EUR 405.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TMEM173 (Trp160~Leu371)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Transmembrane Protein 173 (TMEM173). This antibody is labeled with PE.

Transmembrane Protein 173 (TMEM173) Polyclonal Antibody (Rat), APC

4-PAN011Ra01-APC
  • EUR 388.00
  • EUR 3887.00
  • EUR 1065.00
  • EUR 501.00
  • EUR 237.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TMEM173 (Ala160~Leu363)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Transmembrane Protein 173 (TMEM173). This antibody is labeled with APC.

Transmembrane Protein 173 (TMEM173) Polyclonal Antibody (Rat), Biotinylated

4-PAN011Ra01-Biotin
  • EUR 343.00
  • EUR 2908.00
  • EUR 839.00
  • EUR 425.00
  • EUR 232.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TMEM173 (Ala160~Leu363)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Transmembrane Protein 173 (TMEM173). This antibody is labeled with Biotin.

Transmembrane Protein 173 (TMEM173) Polyclonal Antibody (Rat), Cy3

4-PAN011Ra01-Cy3
  • EUR 476.00
  • EUR 5141.00
  • EUR 1379.00
  • EUR 626.00
  • EUR 275.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TMEM173 (Ala160~Leu363)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Transmembrane Protein 173 (TMEM173). This antibody is labeled with Cy3.

Transmembrane Protein 173 (TMEM173) Polyclonal Antibody (Rat), FITC

4-PAN011Ra01-FITC
  • EUR 330.00
  • EUR 3129.00
  • EUR 872.00
  • EUR 420.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TMEM173 (Ala160~Leu363)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Transmembrane Protein 173 (TMEM173). This antibody is labeled with FITC.

Transmembrane Protein 173 (TMEM173) Polyclonal Antibody (Rat), HRP

4-PAN011Ra01-HRP
  • EUR 353.00
  • EUR 3385.00
  • EUR 940.00
  • EUR 451.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TMEM173 (Ala160~Leu363)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Transmembrane Protein 173 (TMEM173). This antibody is labeled with HRP.

Transmembrane Protein 173 (TMEM173) Polyclonal Antibody (Rat), PE

4-PAN011Ra01-PE
  • EUR 330.00
  • EUR 3129.00
  • EUR 872.00
  • EUR 420.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TMEM173 (Ala160~Leu363)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Transmembrane Protein 173 (TMEM173). This antibody is labeled with PE.

Transmembrane Protein 173 (TMEM173) Polyclonal Antibody (Human, Mouse), APC

4-PAN011Hu01-APC
  • EUR 367.00
  • EUR 3581.00
  • EUR 989.00
  • EUR 470.00
  • EUR 228.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TMEM173 (Leu159~Pro373)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Transmembrane Protein 173 (TMEM173). This antibody is labeled with APC.

Transmembrane Protein 173 (TMEM173) Polyclonal Antibody (Human, Mouse), Biotinylated

4-PAN011Hu01-Biotin
  • EUR 327.00
  • EUR 2684.00
  • EUR 783.00
  • EUR 403.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TMEM173 (Leu159~Pro373)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Transmembrane Protein 173 (TMEM173). This antibody is labeled with Biotin.

Transmembrane Protein 173 (TMEM173) Polyclonal Antibody (Human, Mouse), Cy3

4-PAN011Hu01-Cy3
  • EUR 447.00
  • EUR 4733.00
  • EUR 1277.00
  • EUR 585.00
  • EUR 263.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TMEM173 (Leu159~Pro373)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Transmembrane Protein 173 (TMEM173). This antibody is labeled with Cy3.

Transmembrane Protein 173 (TMEM173) Polyclonal Antibody (Human, Mouse), FITC

4-PAN011Hu01-FITC
  • EUR 313.00
  • EUR 2884.00
  • EUR 811.00
  • EUR 396.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TMEM173 (Leu159~Pro373)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Transmembrane Protein 173 (TMEM173). This antibody is labeled with FITC.

Transmembrane Protein 173 (TMEM173) Polyclonal Antibody (Human, Mouse), HRP

4-PAN011Hu01-HRP
  • EUR 334.00
  • EUR 3120.00
  • EUR 873.00
  • EUR 424.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TMEM173 (Leu159~Pro373)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Transmembrane Protein 173 (TMEM173). This antibody is labeled with HRP.

Transmembrane Protein 173 (TMEM173) Polyclonal Antibody (Human, Mouse), PE

4-PAN011Hu01-PE
  • EUR 313.00
  • EUR 2884.00
  • EUR 811.00
  • EUR 396.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TMEM173 (Leu159~Pro373)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Transmembrane Protein 173 (TMEM173). This antibody is labeled with PE.

Transmembrane Protein 173 (TMEM173) Polyclonal Antibody (Mouse), APC-Cy7

4-PAN011Mu01-APC-Cy7
  • EUR 628.00
  • EUR 7258.00
  • EUR 1912.00
  • EUR 842.00
  • EUR 344.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TMEM173 (Trp160~Leu371)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Transmembrane Protein 173 (TMEM173). This antibody is labeled with APC-Cy7.

Transmembrane Protein 173 (TMEM173) Polyclonal Antibody (Rat), APC-Cy7

4-PAN011Ra01-APC-Cy7
  • EUR 657.00
  • EUR 7654.00
  • EUR 2011.00
  • EUR 882.00
  • EUR 355.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TMEM173 (Ala160~Leu363)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Transmembrane Protein 173 (TMEM173). This antibody is labeled with APC-Cy7.

Transmembrane Protein 173 (TMEM173) Polyclonal Antibody (Human, Mouse), APC-Cy7

4-PAN011Hu01-APC-Cy7
  • EUR 614.00
  • EUR 7042.00
  • EUR 1858.00
  • EUR 821.00
  • EUR 337.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TMEM173 (Leu159~Pro373)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Transmembrane Protein 173 (TMEM173). This antibody is labeled with APC-Cy7.

Transmembrane Protein 173 (TM173) Antibody

abx034495-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Transmembrane Protein 173 (TM173) Antibody

abx034495-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Transmembrane Protein 173 (TM173) Antibody

abx034525-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Transmembrane Protein 173 (TM173) Antibody

abx034525-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

TMEM173 ELISA KIT|Human

EF003662 96 Tests
EUR 689

TMEM173 ELISA Kit (Human) (OKCD00623)

OKCD00623 96 Wells
EUR 909
Description: Description of target: This gene encodes a five transmembrane protein that functions as a major regulator of the innate immune response to viral and bacterial infections. The encoded protein is a pattern recognition receptor that detects cytosolic nucleic acids and transmits signals that activate type I interferon responses. The encoded protein has also been shown to play a role in apoptotic signaling by associating with type II major histocompatibility complex. Mutations in this gene are the cause of infantile-onset STING-associated vasculopathy. Alternate splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.055 ng/mL

TMEM173 Recombinant Protein (Human)

RP032008 100 ug Ask for price

TMEM173 ELISA Kit (Chicken) (OKCA02019)

OKCA02019 96 Wells
EUR 917
Description: Description of target: Facilitator of innate immune signaling that acts as a sensor of cytosolic DNA from bacteria and viruses and promotes the production of type I interferon (IFN-alpha and IFN-beta). Innate immune response is triggered in response to non-CpG double-stranded DNA from viruses and bacteria delivered to the cytoplasm. Acts by recognizing and binding cyclic di-GMP (c-di-GMP), a second messenger produced by bacteria, and cyclic GMP-AMP (cGAMP), a messenger produced in response to DNA virus in the cytosol: upon binding of c-di-GMP or cGAMP, autoinhibition is alleviated and TMEM173/STING is able to activate both NF-kappa-B and IRF3 transcription pathways to induce expression of type I interferon and exert a potent anti-viral state.;Species reactivity: Chicken;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 7.8 pg/mL

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

TMEM173 siRNA

20-abx937153
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TMEM173 siRNA

20-abx937154
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TMEM173 antibody

70R-20869 50 ug
EUR 435
Description: Rabbit polyclonal TMEM173 antibody

TMEM173 antibody

70R-2359 50 ug
EUR 467
Description: Rabbit polyclonal TMEM173 antibody raised against the middle region of TMEM173

TMEM173 Antibody

49658-100ul 100ul
EUR 333

TMEM173 Antibody

49658-50ul 50ul
EUR 239

TMEM173 Antibody

1-CSB-PA005903
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TMEM173. Recognizes TMEM173 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

TMEM173 Antibody

1-CSB-PA023754GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TMEM173. Recognizes TMEM173 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF, FC

TMEM173 Antibody

1-CSB-PA023754LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TMEM173. Recognizes TMEM173 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:200-1:500, IF:1:50-1:200

APF LB Broth Miller

173 500 ml
EUR 68

TMEM173 Recombinant Protein (Mouse)

RP179423 100 ug Ask for price

Human Transmembrane protein 119 ELISA kit

E01T0877-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Transmembrane protein 119 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 119 ELISA kit

E01T0877-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Transmembrane protein 119 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 119 ELISA kit

E01T0877-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Transmembrane protein 119 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human TMEM173 shRNA Plasmid

20-abx967322
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Recombinant Human C1QTNF6 Protein-6His-ABP tag

CTP-173 100ug Ask for price
Description: A 32 kDa recombinant human C1QTNF6 protein Antigen with a GST-tag at N-terminal expressed in E. Coli.

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

HS-173

B1627-25
EUR 436

HS-173

B1627-5
EUR 147

HS-173

B4492-25 25 mg
EUR 325
Description: Phosphatidylinositol 3-kinase (PI3K) was first identified over 20 years ago as a lipid kinase associated with viral oncoproteins.

HS-173

B4492-5 5 mg
EUR 128
Description: Phosphatidylinositol 3-kinase (PI3K) was first identified over 20 years ago as a lipid kinase associated with viral oncoproteins.

HS-173

B4492-5.1 10 mM (in 1mL DMSO)
EUR 154
Description: Phosphatidylinositol 3-kinase (PI3K) was first identified over 20 years ago as a lipid kinase associated with viral oncoproteins.

HS-173

HY-15868 50mg
EUR 670

Human Probable G- protein coupled receptor 173, GPR173 ELISA KIT

ELI-27266h 96 Tests
EUR 824

TMEM173 Conjugated Antibody

C49658 100ul
EUR 397

TMEM173 cloning plasmid

CSB-CL023754HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1140
  • Sequence: atgccccactccagcctgcatccatccatcccgtgtcccaggggtcacggggcccagaaggcagccttggttctgctgagtgcctgcctggtgaccctttgggggctaggagagccaccagagcacactctccggtacctggtgctccacctagcctccctgcagctgggactgc
  • Show more
Description: A cloning plasmid for the TMEM173 gene.

TMEM173 Polyclonal Antibody

ES4218-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TMEM173 from Human/Mouse. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

TMEM173 Polyclonal Antibody

ES4218-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TMEM173 from Human/Mouse. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

anti- TMEM173 antibody

FNab08759 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:100
  • Immunogen: transmembrane protein 173
  • Uniprot ID: Q86WV6
  • Gene ID: 340061
  • Research Area: Cancer, Immunology, Epigenetics
Description: Antibody raised against TMEM173

TMEM173 Polyclonal Antibody

ABP53219-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human TMEM173
  • Applications tips:
Description: A polyclonal antibody for detection of TMEM173 from Human, Mouse. This TMEM173 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human TMEM173

TMEM173 Polyclonal Antibody

ABP53219-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human TMEM173
  • Applications tips:
Description: A polyclonal antibody for detection of TMEM173 from Human, Mouse. This TMEM173 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human TMEM173

TMEM173 Polyclonal Antibody

ABP53219-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human TMEM173
  • Applications tips:
Description: A polyclonal antibody for detection of TMEM173 from Human, Mouse. This TMEM173 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human TMEM173

TMEM173 Blocking Peptide

33R-2109 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TMEM173 antibody, catalog no. 70R-2359

TMEM173 Polyclonal Antibody

41859-100ul 100ul
EUR 252

TMEM173 Polyclonal Antibody

41859-50ul 50ul
EUR 187

TMEM173/STING Antibody

DF12090 200ul
EUR 304
Description: TMEM173/STING antibody detects endogenous levels of TMEM173/STING.

Anti-TMEM173 Antibody

PB9513 100ug/vial
EUR 334

Anti-TMEM173 antibody

PAab08759 100 ug
EUR 386

pCMV-SPORT6-TMEM173

PVT18135 2 ug
EUR 231

Anti-TMEM173 antibody

STJ96853 200 µl
EUR 197
Description: Rabbit polyclonal to TMEM173.

Anti-TMEM173 antibody

STJ25875 100 µl
EUR 277
Description: This gene encodes a five transmembrane protein that functions as a major regulator of the innate immune response to viral and bacterial infections. The encoded protein is a pattern recognition receptor that detects cytosolic nucleic acids and transmits signals that activate type I interferon responses. The encoded protein has also been shown to play a role in apoptotic signaling by associating with type II major histocompatibility complex. Mutations in this gene are the cause of infantile-onset STING-associated vasculopathy. Alternate splicing results in multiple transcript variants.

Anti-TMEM173 antibody

STJ111179 100 µl
EUR 277
Description: This gene encodes a five transmembrane protein that functions as a major regulator of the innate immune response to viral and bacterial infections. The encoded protein is a pattern recognition receptor that detects cytosolic nucleic acids and transmits signals that activate type I interferon responses. The encoded protein has also been shown to play a role in apoptotic signaling by associating with type II major histocompatibility complex. Mutations in this gene are the cause of infantile-onset STING-associated vasculopathy. Alternate splicing results in multiple transcript variants.

Human Transmembrane protein 104(TMEM104) ELISA kit

E01T0699-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 104(TMEM104) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 104(TMEM104) ELISA kit

E01T0699-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 104(TMEM104) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 104(TMEM104) ELISA kit

E01T0699-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 104(TMEM104) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 121(TMEM121) ELISA kit

E01T0701-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 121(TMEM121) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 121(TMEM121) ELISA kit

E01T0701-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 121(TMEM121) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 121(TMEM121) ELISA kit

E01T0701-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 121(TMEM121) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 129(TMEM129) ELISA kit

E01T0702-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 129(TMEM129) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 129(TMEM129) ELISA kit

E01T0702-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 129(TMEM129) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 129(TMEM129) ELISA kit

E01T0702-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 129(TMEM129) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 170A(TMEM170A) ELISA kit

E01T0703-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 170A(TMEM170A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 170A(TMEM170A) ELISA kit

E01T0703-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 170A(TMEM170A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 170A(TMEM170A) ELISA kit

E01T0703-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 170A(TMEM170A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 175(TMEM175) ELISA kit

E01T0705-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 175(TMEM175) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 175(TMEM175) ELISA kit

E01T0705-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 175(TMEM175) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 175(TMEM175) ELISA kit

E01T0705-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 175(TMEM175) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 18(TMEM18) ELISA kit

E01T0706-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 18(TMEM18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 18(TMEM18) ELISA kit

E01T0706-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 18(TMEM18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 18(TMEM18) ELISA kit

E01T0706-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 18(TMEM18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 180(TMEM180) ELISA kit

E01T0707-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 180(TMEM180) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 180(TMEM180) ELISA kit

E01T0707-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 180(TMEM180) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 180(TMEM180) ELISA kit

E01T0707-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 180(TMEM180) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 184C(TMEM184C) ELISA kit

E01T0708-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 184C(TMEM184C) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 184C(TMEM184C) ELISA kit

E01T0708-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 184C(TMEM184C) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 184C(TMEM184C) ELISA kit

E01T0708-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 184C(TMEM184C) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 194B(TMEM194B) ELISA kit

E01T0709-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 194B(TMEM194B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 194B(TMEM194B) ELISA kit

E01T0709-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 194B(TMEM194B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 194B(TMEM194B) ELISA kit

E01T0709-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 194B(TMEM194B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 208(TMEM208) ELISA kit

E01T0710-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 208(TMEM208) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 208(TMEM208) ELISA kit

E01T0710-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 208(TMEM208) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 208(TMEM208) ELISA kit

E01T0710-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 208(TMEM208) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 22(TMEM22) ELISA kit

E01T0711-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 22(TMEM22) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 22(TMEM22) ELISA kit

E01T0711-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 22(TMEM22) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 22(TMEM22) ELISA kit

E01T0711-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 22(TMEM22) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 41B(TMEM41B) ELISA kit

E01T0713-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 41B(TMEM41B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 41B(TMEM41B) ELISA kit

E01T0713-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 41B(TMEM41B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 41B(TMEM41B) ELISA kit

E01T0713-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 41B(TMEM41B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 68(TMEM68) ELISA kit

E01T0714-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 68(TMEM68) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 68(TMEM68) ELISA kit

E01T0714-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 68(TMEM68) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 68(TMEM68) ELISA kit

E01T0714-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 68(TMEM68) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human Transmembrane protein 158

EK2693 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Transmembrane protein 158 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Transmembrane protein 132D

EK4617 96 tests
EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Transmembrane protein 132D in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Transmembrane protein 126A

EK4626 96 tests
EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Transmembrane protein 126A in samples from serum, plasma, tissue homogenates and other biological fluids.

Human TMEM127(Transmembrane protein 127) ELISA Kit

EH4117 96T
EUR 524.1
  • Detection range: 78-5000 pg/ml
  • Uniprot ID: O75204
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml

Human TMEM126A/ Transmembrane protein 126A ELISA Kit

E2519Hu 1 Kit
EUR 605

Human TMEM132D/ Transmembrane protein 132D ELISA Kit

E2520Hu 1 Kit
EUR 605

Human TMEM158/ Transmembrane protein 158 ELISA Kit

E2521Hu 1 Kit
EUR 571

Human TMEM158(Transmembrane protein 158) ELISA Kit

EH1212 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q8WZ71
  • Alias: TMEM158/Transmembrane protein 158/40 kDa BINP-binding protein/p40BBP/Ras-induced senescence protein 1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human TMEM132D(Transmembrane protein 132D) ELISA Kit

EH2284 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q14C87
  • Alias: TMEM132D/Transmembrane protein 132D/Mature oligodendrocytes transmembrane protein(Mature OL transmembrane protein)
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human TMEM126A(Transmembrane protein 126A) ELISA Kit

EH2289 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q9H061
  • Alias: TMEM126A
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Transmembrane protein C20orf46, C20orf46 ELISA KIT

ELI-10133h 96 Tests
EUR 824

Human Transmembrane protein C9orf71, C9orf71 ELISA KIT

ELI-10273h 96 Tests
EUR 824

Human Transmembrane protein C9orf91, C9orf91 ELISA KIT

ELI-10653h 96 Tests
EUR 824

Human Transmembrane protein C9orf123, C9orf123 ELISA KIT

ELI-10970h 96 Tests
EUR 824

Human Transmembrane protein C9orf125, C9orf125 ELISA KIT

ELI-10971h 96 Tests
EUR 824

Human Transmembrane protein 106B, TMEM106B ELISA KIT

ELI-13690h 96 Tests
EUR 824

Human Transmembrane protein 183B, TMEM183B ELISA KIT

ELI-13712h 96 Tests
EUR 824

Human Transmembrane protein 229B, TMEM229B ELISA KIT

ELI-18570h 96 Tests
EUR 824

Human Transmembrane protein 132E, TMEM132E ELISA KIT

ELI-18753h 96 Tests
EUR 824

Human Transmembrane protein 150B, TMEM150B ELISA KIT

ELI-18754h 96 Tests
EUR 824

Human Transmembrane protein 194B, TMEM194B ELISA KIT

ELI-18755h 96 Tests
EUR 824

Human Transmembrane protein 104, TMEM104 ELISA KIT

ELI-22923h 96 Tests
EUR 824

Human Transmembrane protein 110, TMEM110 ELISA KIT

ELI-22925h 96 Tests
EUR 824

Human Transmembrane protein 143, TMEM143 ELISA KIT

ELI-22927h 96 Tests
EUR 824

Human Transmembrane protein 205, TMEM205 ELISA KIT

ELI-22933h 96 Tests
EUR 824

Human Transmembrane protein 39B, TMEM39B ELISA KIT

ELI-22937h 96 Tests
EUR 824

Human Transmembrane protein 26, TMEM26 ELISA KIT

ELI-22980h 96 Tests
EUR 824

Human Transmembrane protein 80, TMEM80 ELISA KIT

ELI-22984h 96 Tests
EUR 824

Human Transmembrane protein 132A, TMEM132A ELISA KIT

ELI-23553h 96 Tests
EUR 824

Human Transmembrane protein C2orf18, C2orf18 ELISA KIT

ELI-24968h 96 Tests
EUR 824

Human Transmembrane protein C1orf70, C1orf70 ELISA KIT

ELI-25022h 96 Tests
EUR 824

Human Transmembrane protein C9orf46, C9orf46 ELISA KIT

ELI-25290h 96 Tests
EUR 824

Human Transmembrane protein C9orf5, C9orf5 ELISA KIT

ELI-25647h 96 Tests
EUR 824

Human Transmembrane protein C10orf57, C10orf57 ELISA KIT

ELI-25797h 96 Tests
EUR 824

Human Transmembrane protein C7orf23, C7orf23 ELISA KIT

ELI-25903h 96 Tests
EUR 824

Human Transmembrane protein C18orf45, C18orf45 ELISA KIT

ELI-26110h 96 Tests
EUR 824

Human Transmembrane protein C16orf54, C16orf54 ELISA KIT

ELI-26166h 96 Tests
EUR 824

Human Transmembrane protein 158, TMEM158 ELISA KIT

ELI-03517h 96 Tests
EUR 824

Human Transmembrane protein 206, TMEM206 ELISA KIT

ELI-16076h 96 Tests
EUR 824

Human Transmembrane protein 213, TMEM213 ELISA KIT

ELI-16078h 96 Tests
EUR 824

Human Transmembrane protein 214, TMEM214 ELISA KIT

ELI-16079h 96 Tests
EUR 824

Human Transmembrane protein 235, TMEM235 ELISA KIT

ELI-16080h 96 Tests
EUR 824

Human Transmembrane protein 50B, TMEM50B ELISA KIT

ELI-16083h 96 Tests
EUR 824

Human Transmembrane protein 88B, TMEM88B ELISA KIT

ELI-16086h 96 Tests
EUR 824

Human Transmembrane protein 9, TMEM9 ELISA KIT

ELI-16307h 96 Tests
EUR 824

Human Transmembrane protein 25, TMEM25 ELISA KIT

ELI-16310h 96 Tests
EUR 824

Human Transmembrane protein 52, TMEM52 ELISA KIT

ELI-16312h 96 Tests
EUR 824

Human Transmembrane protein 60, TMEM60 ELISA KIT

ELI-16314h 96 Tests
EUR 824

Human Transmembrane protein 111, TMEM111 ELISA KIT

ELI-17099h 96 Tests
EUR 824

Human Transmembrane protein 139, TMEM139 ELISA KIT

ELI-17102h 96 Tests
EUR 824

Human Transmembrane protein 154, TMEM154 ELISA KIT

ELI-17104h 96 Tests
EUR 824

Human Transmembrane protein 204, TMEM204 ELISA KIT

ELI-17111h 96 Tests
EUR 824

Human Transmembrane protein 50A, TMEM50A ELISA KIT

ELI-17117h 96 Tests
EUR 824

Human Transmembrane protein 53, TMEM53 ELISA KIT

ELI-17124h 96 Tests
EUR 824

Human Transmembrane protein 72, TMEM72 ELISA KIT

ELI-17128h 96 Tests
EUR 824

Human Transmembrane protein 82, TMEM82 ELISA KIT

ELI-17130h 96 Tests
EUR 824

Human Transmembrane protein 92, TMEM92 ELISA KIT

ELI-17132h 96 Tests
EUR 824

Human Transmembrane protein 42, TMEM42 ELISA KIT

ELI-17216h 96 Tests
EUR 824

Human Transmembrane protein 68, TMEM68 ELISA KIT

ELI-17218h 96 Tests
EUR 824

Human Transmembrane protein 9B, TMEM9B ELISA KIT

ELI-17219h 96 Tests
EUR 824

Human Transmembrane protein 87A, TMEM87A ELISA KIT

ELI-17246h 96 Tests
EUR 824

Human Transmembrane protein 43, TMEM43 ELISA KIT

ELI-17261h 96 Tests
EUR 824

Human Transmembrane protein 71, TMEM71 ELISA KIT

ELI-17265h 96 Tests
EUR 824

Human Transmembrane protein 78, TMEM78 ELISA KIT

ELI-17266h 96 Tests
EUR 824

Human Transmembrane protein 97, TMEM97 ELISA KIT

ELI-17270h 96 Tests
EUR 824

Human Transmembrane protein 14D, TMEM14D ELISA KIT

ELI-17327h 96 Tests
EUR 824

Human Transmembrane protein 165, TMEM165 ELISA KIT

ELI-17328h 96 Tests
EUR 824

Human Transmembrane protein 171, TMEM171 ELISA KIT

ELI-17331h 96 Tests
EUR 824

Human Transmembrane protein 198, TMEM198 ELISA KIT

ELI-17334h 96 Tests
EUR 824

Human Transmembrane protein 199, TMEM199 ELISA KIT

ELI-17335h 96 Tests
EUR 824

Human Transmembrane protein 234, TMEM234 ELISA KIT

ELI-17340h 96 Tests
EUR 824

Human Transmembrane protein 136, TMEM136 ELISA KIT

ELI-17348h 96 Tests
EUR 824

Human Transmembrane protein 14A, TMEM14A ELISA KIT

ELI-17351h 96 Tests
EUR 824

Human Transmembrane protein 187, TMEM187 ELISA KIT

ELI-17356h 96 Tests
EUR 824

Human Transmembrane protein 220, TMEM220 ELISA KIT

ELI-17361h 96 Tests
EUR 824

Human Transmembrane protein 45B, TMEM45B ELISA KIT

ELI-17365h 96 Tests
EUR 824

Human Transmembrane protein C17orf87, C17orf87 ELISA KIT

ELI-09071h 96 Tests
EUR 824

Human Transmembrane protein 222, TMEM222 ELISA KIT

ELI-28228h 96 Tests
EUR 824

Human Transmembrane protein 41A, TMEM41A ELISA KIT

ELI-28229h 96 Tests
EUR 824

Human Transmembrane protein 63B, TMEM63B ELISA KIT

ELI-28232h 96 Tests
EUR 824

Human Transmembrane protein 19, TMEM19 ELISA KIT

ELI-51820h 96 Tests
EUR 824

Human Transmembrane protein 115, TMEM115 ELISA KIT

ELI-51903h 96 Tests
EUR 824

Human Transmembrane protein 125, TMEM125 ELISA KIT

ELI-51904h 96 Tests
EUR 824

Human TMEM173(Transmembrane Protein 173) ELISA Kit