Mouse ADIG(Adipogenin) ELISA Kit

Mouse ADIG(Adipogenin) ELISA Kit

To Order Contact us: [email protected]

Mouse Adipogenin (ADIG) ELISA Kit
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Mouse Adipogenin, Adig ELISA KIT
ELI-49824m 96 Tests
EUR 865
Mouse Adipogenin (ADIG) ELISA Kit
SEE043Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Adipogenin (ADIG) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Adipogenin (ADIG) in Tissue homogenates, cell lysates and other biological fluids.
Mouse Adipogenin (ADIG) ELISA Kit
SEE043Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Adipogenin (ADIG) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Adipogenin (ADIG) in Tissue homogenates, cell lysates and other biological fluids.
Mouse Adipogenin (ADIG) ELISA Kit
SEE043Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Adipogenin (ADIG) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Adipogenin (ADIG) in Tissue homogenates, cell lysates and other biological fluids.
Mouse Adipogenin (ADIG) ELISA Kit
SEE043Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Adipogenin (ADIG) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Adipogenin (ADIG) in Tissue homogenates, cell lysates and other biological fluids.
Mouse Adipogenin (ADIG) ELISA Kit
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Adipogenin elisa. Alternative names of the recognized antigen: SMAF1
  • Adipogenesis Associated
  • Small Adipocyte Factor 1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Adipogenin (ADIG) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.
ELISA kit for Mouse ADIG (Adipogenin)
ELK7532 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Adipogenin (ADIG). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Adipogenin (ADIG
  • Show more
Description: A sandwich ELISA kit for detection of Adipogenin from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
ELISA kit for Mouse Adipogenin (ADIG)
KTE70556-48T 48T
EUR 332
  • ADIG/SMAF1 is an adipocyte-specific protein that plays a role in adipocyte differentiation. The deduced 80-amino acid mouse protein contains an N-terminal region rich in leucine residues, a short stretch of basic amino acids suggestive of a nuclear l
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Adipogenin (ADIG) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Mouse Adipogenin (ADIG)
KTE70556-5platesof96wells 5 plates of 96 wells
EUR 2115
  • ADIG/SMAF1 is an adipocyte-specific protein that plays a role in adipocyte differentiation. The deduced 80-amino acid mouse protein contains an N-terminal region rich in leucine residues, a short stretch of basic amino acids suggestive of a nuclear l
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Adipogenin (ADIG) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Mouse Adipogenin (ADIG)
KTE70556-96T 96T
EUR 539
  • ADIG/SMAF1 is an adipocyte-specific protein that plays a role in adipocyte differentiation. The deduced 80-amino acid mouse protein contains an N-terminal region rich in leucine residues, a short stretch of basic amino acids suggestive of a nuclear l
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Adipogenin (ADIG) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Mouse Adipogenin (ADIG) CLIA Kit
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Human Adipogenin(ADIG) ELISA kit
E01A1272-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Adipogenin(ADIG) ELISA kit
E01A1272-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Adipogenin(ADIG) ELISA kit
E01A1272-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Adipogenin(ADIG) ELISA kit
E02A1272-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Adipogenin(ADIG) ELISA kit
E02A1272-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Adipogenin(ADIG) ELISA kit
E02A1272-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Adipogenin(ADIG) ELISA kit
E06A1272-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Adipogenin(ADIG) ELISA kit
E06A1272-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Adipogenin(ADIG) ELISA kit
E06A1272-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Adipogenin(ADIG) ELISA kit
E04A1272-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Adipogenin(ADIG) ELISA kit
E04A1272-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Adipogenin(ADIG) ELISA kit
E04A1272-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Adipogenin (ADIG) ELISA Kit
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Dog Adipogenin(ADIG) ELISA kit
E08A1272-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Adipogenin(ADIG) ELISA kit
E08A1272-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Adipogenin(ADIG) ELISA kit
E08A1272-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Adipogenin(ADIG) ELISA kit
E09A1272-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Adipogenin(ADIG) ELISA kit
E09A1272-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Adipogenin(ADIG) ELISA kit
E09A1272-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Adipogenin(ADIG) ELISA kit
E07A1272-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Adipogenin(ADIG) ELISA kit
E07A1272-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Adipogenin(ADIG) ELISA kit
E07A1272-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Porcine Adipogenin, ADIG ELISA KIT
ELI-24752p 96 Tests
EUR 928
Human Adipogenin (ADIG) ELISA Kit
abx384552-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Bovine Adipogenin, ADIG ELISA KIT
ELI-34592b 96 Tests
EUR 928
Human Adipogenin, ADIG ELISA KIT
ELI-35149h 96 Tests
EUR 824
Human Adipogenin(ADIG)ELISA Kit
QY-E00227 96T
EUR 361
Human Adipogenin ELISA Kit (ADIG)
RK00828 96 Tests
EUR 521
Human Adipogenin (ADIG) ELISA Kit
SEE043Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Adipogenin (ADIG) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Adipogenin (ADIG) in Tissue homogenates, cell lysates and other biological fluids.
Human Adipogenin (ADIG) ELISA Kit
SEE043Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Adipogenin (ADIG) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Adipogenin (ADIG) in Tissue homogenates, cell lysates and other biological fluids.
Human Adipogenin (ADIG) ELISA Kit
SEE043Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Adipogenin (ADIG) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Adipogenin (ADIG) in Tissue homogenates, cell lysates and other biological fluids.
Human Adipogenin (ADIG) ELISA Kit
SEE043Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Adipogenin (ADIG) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Adipogenin (ADIG) in Tissue homogenates, cell lysates and other biological fluids.
Human Adipogenin (ADIG) ELISA Kit
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Adipogenin elisa. Alternative names of the recognized antigen: SMAF1
  • Adipogenesis Associated
  • Small Adipocyte Factor 1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Adipogenin (ADIG) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.
Adig ELISA Kit| Mouse Adipogenin ELISA Kit
EF014153 96 Tests
EUR 689
Guinea pig Adipogenin(ADIG) ELISA kit
E05A1272-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Guinea pig Adipogenin(ADIG) ELISA kit
E05A1272-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Guinea pig Adipogenin(ADIG) ELISA kit
E05A1272-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
ELISA kit for Human ADIG (Adipogenin)
ELK5260 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Adipogenin (ADIG). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Adipogenin (ADIG
  • Show more
Description: A sandwich ELISA kit for detection of Adipogenin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
ELISA kit for Human Adipogenin (ADIG)
KTE60938-48T 48T
EUR 332
  • ADIG/SMAF1 is an adipocyte-specific protein that plays a role in adipocyte differentiation. The deduced 80-amino acid mouse protein contains an N-terminal region rich in leucine residues, a short stretch of basic amino acids suggestive of a nuclear l
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Adipogenin (ADIG) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Adipogenin (ADIG)
KTE60938-5platesof96wells 5 plates of 96 wells
EUR 2115
  • ADIG/SMAF1 is an adipocyte-specific protein that plays a role in adipocyte differentiation. The deduced 80-amino acid mouse protein contains an N-terminal region rich in leucine residues, a short stretch of basic amino acids suggestive of a nuclear l
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Adipogenin (ADIG) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Adipogenin (ADIG)
KTE60938-96T 96T
EUR 539
  • ADIG/SMAF1 is an adipocyte-specific protein that plays a role in adipocyte differentiation. The deduced 80-amino acid mouse protein contains an N-terminal region rich in leucine residues, a short stretch of basic amino acids suggestive of a nuclear l
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Adipogenin (ADIG) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Human Adipogenin (ADIG) CLIA Kit
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
ADIG ELISA Kit| Bovine Adipogenin ELISA Kit
EF011096 96 Tests
EUR 689
Adig ELISA Kit (Mouse) (OKCD01800)
OKCD01800 96 Wells
EUR 857
Description: Description of target: Plays a role in stimulating adipocyte differentiation and development.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.31 ng/mL
EF004579 96 Tests
EUR 689
Anti-Adipogenin (mouse) antibody
STJ73213 100 µg
EUR 260
Adipogenin Antibody
abx431823-200ul 200 ul
EUR 286
  • Shipped within 1-3 working days.
Adipogenin Antibody
abx431824-200ul 200 ul
EUR 286
  • Shipped within 1-3 working days.
ADIG ELISA Kit (Human) (OKCD01799)
OKCD01799 96 Wells
EUR 831
Description: Description of target: Plays a role in stimulating adipocyte differentiation and development.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.56 ng/mL
Mouse ADIG shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
ADIG Recombinant Protein (Mouse)
RP114521 100 ug Ask for price
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
EUR 202
Adig ORF Vector (Mouse) (pORF)
ORF038175 1.0 ug DNA
EUR 506
Anti-Adipogenin (mouse, aa41-52) antibody
STJ73215 100 µg
EUR 359
ADIG cloning plasmid
CSB-CL001365HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 357
  • Sequence: atgactccagtgtgtgcttggattgggagccctggagcaaaggcccagctgagttttgctggaaggggacactccacggccaagagaaggagaggccctgctggtgagcctgctgtgccaggtgaggcacttccaggggccagggggagcctcaaggcccacccaaagccttgggc
  • Show more
Description: A cloning plasmid for the ADIG gene.
ADIG cloning plasmid
CSB-CL001365HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 243
  • Show more
Description: A cloning plasmid for the ADIG gene.
Adig sgRNA CRISPR Lentivector set (Mouse)
K3276901 3 x 1.0 ug
EUR 339
Frit Kit
FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.
Human ADIG shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
ADIG Recombinant Protein (Human)
RP000601 100 ug Ask for price
ADIG Recombinant Protein (Human)
RP036484 100 ug Ask for price
Column Packing Kit
PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.
PCR Mycoplasma Detection Kit
M034-Kit Kit
EUR 266
Adig sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3276902 1.0 ug DNA
EUR 154
Adig sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3276903 1.0 ug DNA
EUR 154
Adig sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3276904 1.0 ug DNA
EUR 154
ADIG Protein Vector (Mouse) (pPB-C-His)
PV152698 500 ng
EUR 603
ADIG Protein Vector (Mouse) (pPB-N-His)
PV152699 500 ng
EUR 603
ADIG Protein Vector (Mouse) (pPM-C-HA)
PV152700 500 ng
EUR 603
ADIG Protein Vector (Mouse) (pPM-C-His)
PV152701 500 ng
EUR 603
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9
ADIG ORF Vector (Human) (pORF)
ORF000201 1.0 ug DNA
EUR 95
ADIG ORF Vector (Human) (pORF)
ORF012162 1.0 ug DNA
EUR 354
CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
EUR 1132
  • Category: Cas9
CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
EUR 1132
  • Category: Cas9
MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
EUR 1132
  • Category: Cas9
MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9
Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
EUR 1132
  • Category: Cas9
Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
EUR 1132
  • Category: Cas9
Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
EUR 1132
  • Category: Cas9
Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]
EUR 153
  • Category: Cas9
PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools
PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools
ADIG sgRNA CRISPR Lentivector set (Human)
K0050301 3 x 1.0 ug
EUR 339
AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE620A-KIT 1 kit
EUR 2132
  • Category: Gene Editing
AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE622A-KIT 1 kit
EUR 2132
  • Category: Gene Editing
AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE624A-KIT 1 kit
EUR 2132
  • Category: Gene Editing
vWF Acty. Kit
ABP-ACT-KIT 12 x 8 microwells
EUR 428
vWF Ant. Kit
ABP-TOT-KIT 12 x 8 microwells
EUR 394
Adig sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3276905 3 x 1.0 ug
EUR 376
ADIG sgRNA CRISPR Lentivector (Human) (Target 1)
K0050302 1.0 ug DNA
EUR 154
ADIG sgRNA CRISPR Lentivector (Human) (Target 2)
K0050303 1.0 ug DNA
EUR 154
ADIG sgRNA CRISPR Lentivector (Human) (Target 3)
K0050304 1.0 ug DNA
EUR 154
ADIG Protein Vector (Human) (pPB-His-MBP)
PV320118 500 ng
EUR 329
ADIG Protein Vector (Human) (pPB-His-GST)
PV320119 500 ng
EUR 329
ADIG Protein Vector (Human) (pPB-C-His)
PV000801 500 ng
EUR 329
ADIG Protein Vector (Human) (pPB-N-His)
PV000802 500 ng
EUR 329
ADIG Protein Vector (Human) (pPM-C-HA)
PV000803 500 ng
EUR 329
ADIG Protein Vector (Human) (pPM-C-His)
PV000804 500 ng
EUR 329
ADIG Protein Vector (Human) (pPB-C-His)
PV048645 500 ng
EUR 481
ADIG Protein Vector (Human) (pPB-N-His)
PV048646 500 ng
EUR 481
ADIG Protein Vector (Human) (pPM-C-HA)
PV048647 500 ng
EUR 481
ADIG Protein Vector (Human) (pPM-C-His)
PV048648 500 ng
EUR 481
Adig 3'UTR Luciferase Stable Cell Line
TU101445 1.0 ml Ask for price
Adig 3'UTR GFP Stable Cell Line
TU151445 1.0 ml Ask for price
ADIG 3'UTR GFP Stable Cell Line
TU050382 1.0 ml
EUR 1394
ADIG 3'UTR Luciferase Stable Cell Line
TU000382 1.0 ml
EUR 1394
hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9)
CAS620A-KIT 1 kit
EUR 2152
  • Category: Cas9
Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression)
PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools
PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools
PrecisionX Multiplex gRNA Cloning Kit
CAS9-GRNA-KIT 10 rxn
EUR 445
  • Category: Cas9
mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products
Adig sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K3276906 1.0 ug DNA
EUR 167
Adig sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K3276907 1.0 ug DNA
EUR 167
Adig sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K3276908 1.0 ug DNA
EUR 167
ADIG Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV703011 1.0 ug DNA
EUR 450
ADIG Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV703015 1.0 ug DNA
EUR 450
ADIG Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV703016 1.0 ug DNA
EUR 450

Mouse ADIG(Adipogenin) ELISA Kit