Mouse ADIG(Adipogenin) ELISA Kit
To Order Contact us: [email protected]
 ELISA Kit) Mouse Adipogenin (ADIG) ELISA Kit |
|
20-abx258045 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Mouse Adipogenin (ADIG) ELISA Kit |
|
SEE043Mu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4862.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Adipogenin (ADIG) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Adipogenin (ADIG) in Tissue homogenates, cell lysates and other biological fluids. |
Mouse Adipogenin (ADIG) ELISA Kit |
|
SEE043Mu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 488.08 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Adipogenin (ADIG) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Adipogenin (ADIG) in Tissue homogenates, cell lysates and other biological fluids. |
Mouse Adipogenin (ADIG) ELISA Kit |
|
SEE043Mu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 654.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Adipogenin (ADIG) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Adipogenin (ADIG) in Tissue homogenates, cell lysates and other biological fluids. |
Mouse Adipogenin (ADIG) ELISA Kit |
|
SEE043Mu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2644.8 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Adipogenin (ADIG) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Adipogenin (ADIG) in Tissue homogenates, cell lysates and other biological fluids. |
Mouse Adipogenin (ADIG) ELISA Kit |
|
4-SEE043Mu |
Cloud-Clone |
-
EUR 4913.00
-
EUR 2595.00
-
EUR 655.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Adipogenin elisa. Alternative names of the recognized antigen: SMAF1
- Adipogenesis Associated
- Small Adipocyte Factor 1
|
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Adipogenin (ADIG) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
) ELISA kit for Mouse ADIG (Adipogenin) |
|
ELK7532 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Adipogenin (ADIG). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Adipogenin (ADIG
- Show more
|
|
Description: A sandwich ELISA kit for detection of Adipogenin from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
) ELISA kit for Mouse Adipogenin (ADIG) |
|
KTE70556-48T |
Abbkine |
48T |
EUR 332 |
- ADIG/SMAF1 is an adipocyte-specific protein that plays a role in adipocyte differentiation. The deduced 80-amino acid mouse protein contains an N-terminal region rich in leucine residues, a short stretch of basic amino acids suggestive of a nuclear l
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Mouse Adipogenin (ADIG) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Adipogenin (ADIG) |
|
KTE70556-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- ADIG/SMAF1 is an adipocyte-specific protein that plays a role in adipocyte differentiation. The deduced 80-amino acid mouse protein contains an N-terminal region rich in leucine residues, a short stretch of basic amino acids suggestive of a nuclear l
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Mouse Adipogenin (ADIG) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Adipogenin (ADIG) |
|
KTE70556-96T |
Abbkine |
96T |
EUR 539 |
- ADIG/SMAF1 is an adipocyte-specific protein that plays a role in adipocyte differentiation. The deduced 80-amino acid mouse protein contains an N-terminal region rich in leucine residues, a short stretch of basic amino acids suggestive of a nuclear l
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Mouse Adipogenin (ADIG) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
 CLIA Kit) Mouse Adipogenin (ADIG) CLIA Kit |
|
20-abx494490 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
|
 ELISA kit) Human Adipogenin(ADIG) ELISA kit |
|
E01A1272-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Human Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Adipogenin(ADIG) ELISA kit |
|
E01A1272-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Human Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Adipogenin(ADIG) ELISA kit |
|
E01A1272-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Human Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 ELISA kit) Rat Adipogenin(ADIG) ELISA kit |
|
E02A1272-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Rat Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Adipogenin(ADIG) ELISA kit |
|
E02A1272-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Rat Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Adipogenin(ADIG) ELISA kit |
|
E02A1272-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Rat Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 ELISA kit) Goat Adipogenin(ADIG) ELISA kit |
|
E06A1272-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Goat Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Adipogenin(ADIG) ELISA kit |
|
E06A1272-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Goat Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Adipogenin(ADIG) ELISA kit |
|
E06A1272-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Goat Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 ELISA kit) Rabbit Adipogenin(ADIG) ELISA kit |
|
E04A1272-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Adipogenin(ADIG) ELISA kit |
|
E04A1272-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Adipogenin(ADIG) ELISA kit |
|
E04A1272-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 ELISA Kit) Human Adipogenin (ADIG) ELISA Kit |
|
20-abx156916 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
 ELISA kit) Dog Adipogenin(ADIG) ELISA kit |
|
E08A1272-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Canine Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Adipogenin(ADIG) ELISA kit |
|
E08A1272-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Canine Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Adipogenin(ADIG) ELISA kit |
|
E08A1272-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Canine Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 ELISA kit) Monkey Adipogenin(ADIG) ELISA kit |
|
E09A1272-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Monkey Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Adipogenin(ADIG) ELISA kit |
|
E09A1272-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Monkey Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Adipogenin(ADIG) ELISA kit |
|
E09A1272-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Monkey Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 ELISA kit) Pig Adipogenin(ADIG) ELISA kit |
|
E07A1272-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Porcine Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Adipogenin(ADIG) ELISA kit |
|
E07A1272-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Porcine Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Adipogenin(ADIG) ELISA kit |
|
E07A1272-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Porcine Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Adipogenin (ADIG) ELISA Kit |
|
abx384552-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
) Human Adipogenin ELISA Kit (ADIG) |
|
RK00828 |
Abclonal |
96 Tests |
EUR 521 |
Human Adipogenin (ADIG) ELISA Kit |
|
SEE043Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Adipogenin (ADIG) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Adipogenin (ADIG) in Tissue homogenates, cell lysates and other biological fluids. |
Human Adipogenin (ADIG) ELISA Kit |
|
SEE043Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Adipogenin (ADIG) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Adipogenin (ADIG) in Tissue homogenates, cell lysates and other biological fluids. |
Human Adipogenin (ADIG) ELISA Kit |
|
SEE043Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Adipogenin (ADIG) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Adipogenin (ADIG) in Tissue homogenates, cell lysates and other biological fluids. |
Human Adipogenin (ADIG) ELISA Kit |
|
SEE043Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Adipogenin (ADIG) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Adipogenin (ADIG) in Tissue homogenates, cell lysates and other biological fluids. |
Human Adipogenin (ADIG) ELISA Kit |
|
4-SEE043Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Adipogenin elisa. Alternative names of the recognized antigen: SMAF1
- Adipogenesis Associated
- Small Adipocyte Factor 1
|
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Adipogenin (ADIG) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
 ELISA kit) Guinea pig Adipogenin(ADIG) ELISA kit |
|
E05A1272-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Guinea pig Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Adipogenin(ADIG) ELISA kit |
|
E05A1272-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Guinea pig Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Adipogenin(ADIG) ELISA kit |
|
E05A1272-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Guinea pig Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
) ELISA kit for Human ADIG (Adipogenin) |
|
ELK5260 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Adipogenin (ADIG). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Adipogenin (ADIG
- Show more
|
|
Description: A sandwich ELISA kit for detection of Adipogenin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
) ELISA kit for Human Adipogenin (ADIG) |
|
KTE60938-48T |
Abbkine |
48T |
EUR 332 |
- ADIG/SMAF1 is an adipocyte-specific protein that plays a role in adipocyte differentiation. The deduced 80-amino acid mouse protein contains an N-terminal region rich in leucine residues, a short stretch of basic amino acids suggestive of a nuclear l
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Human Adipogenin (ADIG) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Adipogenin (ADIG) |
|
KTE60938-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- ADIG/SMAF1 is an adipocyte-specific protein that plays a role in adipocyte differentiation. The deduced 80-amino acid mouse protein contains an N-terminal region rich in leucine residues, a short stretch of basic amino acids suggestive of a nuclear l
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Human Adipogenin (ADIG) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Adipogenin (ADIG) |
|
KTE60938-96T |
Abbkine |
96T |
EUR 539 |
- ADIG/SMAF1 is an adipocyte-specific protein that plays a role in adipocyte differentiation. The deduced 80-amino acid mouse protein contains an N-terminal region rich in leucine residues, a short stretch of basic amino acids suggestive of a nuclear l
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Human Adipogenin (ADIG) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
 CLIA Kit) Human Adipogenin (ADIG) CLIA Kit |
|
20-abx494489 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
|
 (OKCD01800)) Adig ELISA Kit (Mouse) (OKCD01800) |
|
OKCD01800 |
Aviva Systems Biology |
96 Wells |
EUR 857 |
|
Description: Description of target: Plays a role in stimulating adipocyte differentiation and development.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.31 ng/mL |
 Adipogenin Antibody |
|
abx431823-200ul |
Abbexa |
200 ul |
EUR 286 |
- Shipped within 1-3 working days.
|
Adipogenin Antibody |
|
abx431824-200ul |
Abbexa |
200 ul |
EUR 286 |
- Shipped within 1-3 working days.
|
 (OKCD01799)) ADIG ELISA Kit (Human) (OKCD01799) |
|
OKCD01799 |
Aviva Systems Biology |
96 Wells |
EUR 831 |
|
Description: Description of target: Plays a role in stimulating adipocyte differentiation and development.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.56 ng/mL |
 Mouse ADIG shRNA Plasmid |
|
20-abx982832 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) ADIG Recombinant Protein (Mouse) |
|
RP114521 |
ABM |
100 ug |
Ask for price |
 ADIG siRNA |
|
20-abx906864 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ADIG siRNA |
|
20-abx906865 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
|
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
 (pORF)) Adig ORF Vector (Mouse) (pORF) |
|
ORF038175 |
ABM |
1.0 ug DNA |
EUR 506 |
 ADIG cloning plasmid |
|
CSB-CL001365HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 357
- Sequence: atgactccagtgtgtgcttggattgggagccctggagcaaaggcccagctgagttttgctggaaggggacactccacggccaagagaaggagaggccctgctggtgagcctgctgtgccaggtgaggcacttccaggggccagggggagcctcaaggcccacccaaagccttgggc
- Show more
|
|
Description: A cloning plasmid for the ADIG gene. |
ADIG cloning plasmid |
|
CSB-CL001365HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 243
- Sequence: ATGAAGTACCCTTTGATGCCGCTGGTGAACGACCTCACATTTTCTTTCCTGGTTTTCTGGTTCTGCCTCCCTGTGGGTTTGCTGTTGTTATTGATCATCTGGCTACGCTTCTTACTTAGCCAAGATTCAGAGGAAAATGACTCCAGTGTGTGCTTGGATTGGGAGCCCTGGAGCAA
- Show more
|
|
Description: A cloning plasmid for the ADIG gene. |
) Adig sgRNA CRISPR Lentivector set (Mouse) |
|
K3276901 |
ABM |
3 x 1.0 ug |
EUR 339 |
 Frit Kit |
|
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
|
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
 Human ADIG shRNA Plasmid |
|
20-abx965628 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) ADIG Recombinant Protein (Human) |
|
RP000601 |
ABM |
100 ug |
Ask for price |
ADIG Recombinant Protein (Human) |
|
RP036484 |
ABM |
100 ug |
Ask for price |
 Column Packing Kit |
|
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
|
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
 PCR Mycoplasma Detection Kit |
|
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
 (Target 1)) Adig sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K3276902 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Adig sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K3276903 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Adig sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K3276904 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) ADIG Protein Vector (Mouse) (pPB-C-His) |
|
PV152698 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) ADIG Protein Vector (Mouse) (pPB-N-His) |
|
PV152699 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) ADIG Protein Vector (Mouse) (pPM-C-HA) |
|
PV152700 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) ADIG Protein Vector (Mouse) (pPM-C-His) |
|
PV152701 |
ABM |
500 ng |
EUR 603 |
 Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit |
|
CAS400A-KIT |
SBI |
1 kit (10 rxn) |
EUR 1110 |
|
|
 (pORF)) ADIG ORF Vector (Human) (pORF) |
|
ORF000201 |
ABM |
1.0 ug DNA |
EUR 95 |
ADIG ORF Vector (Human) (pORF) |
|
ORF012162 |
ABM |
1.0 ug DNA |
EUR 354 |
 CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
|
CASLV100PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
|
 CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
|
CASLV105PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
|
 MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
|
CASLV120PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
|
 MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
|
CASLV125PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
|
 Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
|
CAS700A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
|
 Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
|
CAS720A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
|
 Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
|
CAS740A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
|
) T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents) |
|
CAS510A-KIT |
SBI |
1 Kit |
EUR 805 |
|
|
-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit) Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
|
CASLV200PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
|
-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit) Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
|
CASLV205PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
|
Mouse ADIG(Adipogenin) ELISA Kit
ELISA Kit)
 antibody)
 antibody)