Human MLH3(MutL Homolog 3) ELISA Kit
To Order Contact us: [email protected]
Human MutL Homolog 3 (MLH3) ELISA Kit |
4-SEL736Hu |
Cloud-Clone |
-
EUR 5240.00
-
EUR 2769.00
-
EUR 693.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as MutL Homolog 3 elisa. Alternative names of the recognized antigen: HNPCC7
- DNA mismatch repair protein Mlh3
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human MutL Homolog 3 (MLH3) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
MutL Homolog 3 (MLH3) Antibody |
abx146077-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
MutL Homolog 3 (MLH3) Antibody |
20-abx006534 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
MutL Homolog 3 (MLH3) Antibody |
20-abx014047 |
Abbexa |
-
EUR 314.00
-
EUR 98.00
-
EUR 398.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
200 ug
-
300 µg
|
- Shipped within 5-10 working days.
|
MutL Homolog 3 (MLH3) Antibody |
20-abx324670 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MutL Homolog 3 (MLH3) Antibody |
abx331047-100ul |
Abbexa |
100 ul |
EUR 425 |
- Shipped within 5-10 working days.
|
MutL Homolog 3 (MLH3) Antibody |
abx432972-200ul |
Abbexa |
200 ul |
EUR 286 |
- Shipped within 1-3 working days.
|
Human MutL Homolog 3 (MLH3) CLIA Kit |
20-abx495965 |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
ELISA kit for Human MLH3 (MutL Homolog 3) |
ELK7522 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to MutL Homolog 3 (MLH3). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to MutL Homolog
- Show more
|
Description: A sandwich ELISA kit for detection of MutL Homolog 3 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Human MutL Homolog 1 (MLH1) ELISA Kit |
20-abx152407 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human MutL Homolog 1 (MLH1) ELISA Kit |
DLR-MLH1-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human MutL Homolog 1 (MLH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human MutL Homolog 1 (MLH1) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human MutL Homolog 1 (MLH1) ELISA Kit |
DLR-MLH1-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human MutL Homolog 1 (MLH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human MutL Homolog 1 (MLH1) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human MutL Homolog 1 ELISA Kit (MLH1) |
RK01858 |
Abclonal |
96 Tests |
EUR 521 |
Human MutL Homolog 1 (MLH1) ELISA Kit |
RD-MLH1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human MutL Homolog 1 (MLH1) ELISA Kit |
RD-MLH1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human MutL Homolog 1 (MLH1) ELISA Kit |
RDR-MLH1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human MutL Homolog 1 (MLH1) ELISA Kit |
RDR-MLH1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human MutL Homolog 1 (MLH1) ELISA Kit |
SEJ742Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human MutL Homolog 1 (MLH1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human MutL Homolog 1 (MLH1) in tissue homogenates, cell lysates and other biological fluids. |
Human MutL Homolog 1 (MLH1) ELISA Kit |
SEJ742Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human MutL Homolog 1 (MLH1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human MutL Homolog 1 (MLH1) in tissue homogenates, cell lysates and other biological fluids. |
Human MutL Homolog 1 (MLH1) ELISA Kit |
SEJ742Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human MutL Homolog 1 (MLH1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human MutL Homolog 1 (MLH1) in tissue homogenates, cell lysates and other biological fluids. |
Human MutL Homolog 1 (MLH1) ELISA Kit |
SEJ742Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human MutL Homolog 1 (MLH1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human MutL Homolog 1 (MLH1) in tissue homogenates, cell lysates and other biological fluids. |
Human MutL Homolog 1 (MLH1) ELISA Kit |
4-SEJ742Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as MutL Homolog 1 elisa. Alternative names of the recognized antigen: COCA2
- FCC2
- HNPCC
- HNPCC2
- hMLH1
- DNA mismatch repair protein Mlh1
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human MutL Homolog 1 (MLH1) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
ELISA kit for Human MLH1 (MutL Homolog 1) |
ELK4307 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to MutL Homolog 1 (MLH1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to MutL Homolog
- Show more
|
Description: A sandwich ELISA kit for detection of MutL Homolog 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
MLH1 (MutL Homolog 1) |
MO47010 |
Neuromics |
100 ul |
EUR 349 |
Human MutL Homolog 1 (MLH1) CLIA Kit |
20-abx495774 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Human MutL Homolog 1 (MLH1) Protein |
20-abx654421 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
MutL Homolog 1 (MLH1) Antibody |
20-abx113897 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MutL Homolog 1 (MLH1) Antibody |
20-abx000639 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
MutL Homolog 1 (MLH1) Antibody |
20-abx002899 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MutL Homolog 1 (MLH1) Antibody |
20-abx008989 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
MutL Homolog 1 (MLH1) Antibody |
abx012221-100ul |
Abbexa |
100 ul |
EUR 411 |
- Shipped within 5-10 working days.
|
MutL Homolog 1 (MLH1) Antibody |
abx025515-100ul |
Abbexa |
100 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
MutL Homolog 1 (MLH1) Antibody |
abx026385-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
MutL Homolog 1 (MLH1) Antibody |
abx026385-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
MutL Homolog 1 (MLH1) Antibody |
20-abx014046 |
Abbexa |
-
EUR 314.00
-
EUR 98.00
-
EUR 398.00
-
EUR 119.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
200 ug
-
20 ug
-
300 µg
|
- Shipped within 5-10 working days.
|
MutL Homolog 1 (MLH1) Antibody |
20-abx173641 |
Abbexa |
|
|
|
MutL Homolog 1 (MLH1) Antibody |
20-abx177638 |
Abbexa |
|
|
|
MutL Homolog 1 (MLH1) Antibody |
20-abx328114 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MutL Homolog 1 (MLH1) Antibody |
20-abx317973 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
MutL Homolog 1 (MLH1) Antibody |
20-abx241566 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MutL Homolog 1 (MLH1) Antibody |
20-abx241567 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MutL Homolog 1 (MLH1) Antibody |
abx235213-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Human DNA mismatch repair protein Mlh3, MLH3 ELISA KIT |
ELI-23045h |
Lifescience Market |
96 Tests |
EUR 824 |
MLH3 ELISA Kit (Human) (OKCD02059) |
OKCD02059 |
Aviva Systems Biology |
96 Wells |
EUR 909 |
Description: Description of target: Probably involved in the repair of mismatches in DNA. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.063 ng/mL |
MutL Homolog 1 (MLH1) Antibody (HRP) |
20-abx313263 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
MutL Homolog 1 (MLH1) Antibody (FITC) |
20-abx313264 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
MutL Homolog 1 (MLH1) Antibody (Biotin) |
20-abx313265 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
MLH3 siRNA |
20-abx924236 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MLH3 antibody |
70R-5576 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal MLH3 antibody |
MLH3 antibody |
70R-33834 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal MLH3 antibody |
MLH3 Antibody |
34287-100ul |
SAB |
100ul |
EUR 252 |
MLH3 Antibody |
34287-50ul |
SAB |
50ul |
EUR 187 |
MLH3 Antibody |
DF3622 |
Affbiotech |
200ul |
EUR 304 |
Description: MLH3 Antibody detects endogenous levels of total MLH3. |
MLH3 Antibody |
CSB-PA262280- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against MLH3. Recognizes MLH3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000 |
MLH3 Antibody |
CSB-PA262280-100ul |
Cusabio |
100ul |
EUR 316 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against MLH3. Recognizes MLH3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000 |
MLH3 Antibody |
1-CSB-PA008838 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against MLH3. Recognizes MLH3 from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000 |
mutL Antibody |
1-CSB-PA543397HA01ENV |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against mutL. Recognizes mutL from Escherichia coli. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000 |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
Human MLH3 shRNA Plasmid |
20-abx958928 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
MLH3 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1307704 |
ABM |
1.0 ug DNA |
EUR 154 |
DNA Mismatch Repair Protein MutL (mutL) Antibody |
20-abx300647 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
MLH3 Conjugated Antibody |
C34287 |
SAB |
100ul |
EUR 397 |
MLH3 Polyclonal Antibody |
ES5531-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MLH3 from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
MLH3 Polyclonal Antibody |
ES5531-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MLH3 from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
MLH3 Polyclonal Antibody |
ABP54532-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from the Internal region of human MLH3 at AA rangle: 490-570
- Applications tips:
|
Description: A polyclonal antibody for detection of MLH3 from Human. This MLH3 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human MLH3 at AA rangle: 490-570 |
MLH3 Polyclonal Antibody |
ABP54532-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from the Internal region of human MLH3 at AA rangle: 490-570
- Applications tips:
|
Description: A polyclonal antibody for detection of MLH3 from Human. This MLH3 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human MLH3 at AA rangle: 490-570 |
MLH3 Polyclonal Antibody |
ABP54532-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from the Internal region of human MLH3 at AA rangle: 490-570
- Applications tips:
|
Description: A polyclonal antibody for detection of MLH3 from Human. This MLH3 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human MLH3 at AA rangle: 490-570 |
MLH3 Rabbit pAb |
A7796-100ul |
Abclonal |
100 ul |
EUR 308 |
MLH3 Rabbit pAb |
A7796-200ul |
Abclonal |
200 ul |
EUR 459 |
MLH3 Rabbit pAb |
A7796-20ul |
Abclonal |
20 ul |
EUR 183 |
MLH3 Rabbit pAb |
A7796-50ul |
Abclonal |
50 ul |
EUR 223 |
MLH3 Blocking Peptide |
33R-8644 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MLH3 antibody, catalog no. 70R-5576 |
MLH3 cloning plasmid |
CSB-CL883389HU-10ug |
Cusabio |
10ug |
EUR 1680 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 4290
- Sequence: atgatcaagtgcttgtcagttgaagtacaagccaaattgcgttctggtttggccataagctccttgggccaatgtgttgaggaacttgccctcaacagtattgatgctgaagcaaaatgtgtggctgtcagggtgaatatggaaaccttccaagttcaagtgatagacaatggat
- Show more
|
Description: A cloning plasmid for the MLH3 gene. |
MLH3 Blocking Peptide |
DF3622-BP |
Affbiotech |
1mg |
EUR 195 |
Anti-MLH3 antibody |
STJ94146 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to MLH3. |
Anti-MLH3 antibody |
STJ110106 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene is a member of the MutL-homolog (MLH) family of DNA mismatch repair (MMR) genes. MLH genes are implicated in maintaining genomic integrity during DNA replication and after meiotic recombination. The protein encoded by this gene functions as a heterodimer with other family members. Somatic mutations in this gene frequently occur in tumors exhibiting microsatellite instability, and germline mutations have been linked to hereditary nonpolyposis colorectal cancer type 7 (HNPCC7). Several alternatively spliced transcript variants have been identified, but the full-length nature of only two transcript variants has been determined. |
DNA Mismatch Repair Protein MutL (MUTL) Antibody (HRP) |
20-abx300789 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
DNA Mismatch Repair Protein MutL (MUTL) Antibody (FITC) |
20-abx300790 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
DNA Mismatch Repair Protein MutL (MUTL) Antibody (Biotin) |
20-abx300791 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Escherichia coli DNA mismatch repair protein MutL (mutL) |
1-CSB-EP543397ENV |
Cusabio |
-
EUR 611.00
-
EUR 309.00
-
EUR 1827.00
-
EUR 939.00
-
EUR 1218.00
-
EUR 397.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 71.9 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Escherichia coli DNA mismatch repair protein MutL(mutL) expressed in E.coli |
MLH3 ORF Vector (Human) (pORF) |
ORF013785 |
ABM |
1.0 ug DNA |
EUR 354 |
FSH (Human Follicle-stimulating hormone) ELISA test |
3 |
Biobase |
96T/Box |
Ask for price |
- Area of application: Hormone testing
|
Description: ELISA based test for quantitative detection of FSH (Human Follicle-stimulating hormone) |
Human Chromobox Homolog 3 ELISA kit |
E01C0608-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Chromobox Homolog 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Chromobox Homolog 3 ELISA kit |
E01C0608-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Chromobox Homolog 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Chromobox Homolog 3 ELISA kit |
E01C0608-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Chromobox Homolog 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mlh3 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4603104 |
ABM |
1.0 ug DNA |
EUR 154 |
Mlh3 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6734904 |
ABM |
1.0 ug DNA |
EUR 154 |
Mlh3 3'UTR GFP Stable Cell Line |
TU163241 |
ABM |
1.0 ml |
Ask for price |
Mlh3 3'UTR Luciferase Stable Cell Line |
TU213232 |
ABM |
1.0 ml |
Ask for price |
MLH3 3'UTR Luciferase Stable Cell Line |
TU014349 |
ABM |
1.0 ml |
EUR 2333 |
Mlh3 3'UTR Luciferase Stable Cell Line |
TU113241 |
ABM |
1.0 ml |
Ask for price |
MLH3 3'UTR GFP Stable Cell Line |
TU064349 |
ABM |
1.0 ml |
EUR 2333 |
Mlh3 3'UTR GFP Stable Cell Line |
TU263232 |
ABM |
1.0 ml |
Ask for price |
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
MLH3 sgRNA CRISPR Lentivector set (Human) |
K1307701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Column Packing Kit |
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
mutL Antibody, HRP conjugated |
1-CSB-PA543397HB01ENV |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against mutL. Recognizes mutL from Escherichia coli. This antibody is HRP conjugated. Tested in the following application: ELISA |
mutL Antibody, FITC conjugated |
1-CSB-PA543397HC01ENV |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against mutL. Recognizes mutL from Escherichia coli. This antibody is FITC conjugated. Tested in the following application: ELISA |
mutL Antibody, Biotin conjugated |
1-CSB-PA543397HD01ENV |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against mutL. Recognizes mutL from Escherichia coli. This antibody is Biotin conjugated. Tested in the following application: ELISA |
ELISA kit for Human Tribbles homolog 3 |
EK5052 |
SAB |
96 tests |
EUR 603 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Tribbles homolog 3 in samples from serum, plasma, tissue homogenates and other biological fluids. |
Human TRIB3/ Tribbles homolog 3 ELISA Kit |
E2588Hu |
Sunlong |
1 Kit |
EUR 605 |
Human TRIB3(Tribbles homolog 3) ELISA Kit |
EH2519 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: Q96RU7
- Alias: TRIB3/Tribbles homolog 3(TRB-3)/p65-interacting inhibitor of NF-kappa-B/Neuronal cell death-inducible putative kinase/SINK
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
Human CBX3(Chromobox Homolog 3) ELISA Kit |
EH2768 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: Q13185
- Alias: CBX3
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
Human Roundabout homolog 3, ROBO3 ELISA KIT |
ELI-41311h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Chromobox Homolog 3 (CBX3) ELISA Kit |
20-abx151066 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Slingshot Homolog 3 (SSH3) ELISA Kit |
20-abx153113 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Slit Homolog 3 (Slit3) ELISA Kit |
20-abx153116 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Notch Homolog 3 (NOTCH3) ELISA Kit |
20-abx258645 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Canopy 3 Homolog (CNPY3) ELISA Kit |
abx386611-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Tribbles homolog 3 (TRIB3) ELISA Kit |
abx251890-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Chromobox Homolog 3 (CBX3) ELISA Kit |
abx252146-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Frizzled Homolog 3 (FZD3) ELISA Kit |
abx250521-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Frizzled Homolog 3 (FZD3)ELISA Kit |
201-12-2371 |
SunredBio |
96 tests |
EUR 440 |
- This Frizzled Homolog 3 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Slit Homolog 3 (Slit3)ELISA Kit |
201-12-2566 |
SunredBio |
96 tests |
EUR 440 |
- This Slit Homolog 3 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Chromobox Homolog 3 (CBX3)ELISA Kit |
201-12-2896 |
SunredBio |
96 tests |
EUR 440 |
- This Chromobox Homolog 3 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Chromobox Homolog 3 (CBX3) ELISA Kit |
DLR-CBX3-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Chromobox Homolog 3 (CBX3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Chromobox Homolog 3 (CBX3) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human MLH3(MutL Homolog 3) ELISA Kit