Human MLH3(MutL Homolog 3) ELISA Kit

Human MLH3(MutL Homolog 3) ELISA Kit

To Order Contact us: [email protected]

Human MutL Homolog 3 (MLH3) ELISA Kit
  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as MutL Homolog 3 elisa. Alternative names of the recognized antigen: HNPCC7
  • DNA mismatch repair protein Mlh3
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human MutL Homolog 3 (MLH3) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.
MutL Homolog 3 (MLH3) Antibody
abx146077-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
MutL Homolog 3 (MLH3) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
MutL Homolog 3 (MLH3) Antibody
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.
MutL Homolog 3 (MLH3) Antibody
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
MutL Homolog 3 (MLH3) Antibody
abx331047-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.
MutL Homolog 3 (MLH3) Antibody
abx432972-200ul 200 ul
EUR 286
  • Shipped within 1-3 working days.
Human MutL Homolog 3 (MLH3) CLIA Kit
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
ELISA kit for Human MLH3 (MutL Homolog 3)
ELK7522 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to MutL Homolog 3 (MLH3). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to MutL Homolog
  • Show more
Description: A sandwich ELISA kit for detection of MutL Homolog 3 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Human MutL Homolog 1 (MLH1) ELISA Kit
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human MutL Homolog 1 (MLH1) ELISA Kit
DLR-MLH1-Hu-48T 48T
EUR 517
  • Should the Human MutL Homolog 1 (MLH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human MutL Homolog 1 (MLH1) in samples from tissue homogenates, cell lysates or other biological fluids.
Human MutL Homolog 1 (MLH1) ELISA Kit
DLR-MLH1-Hu-96T 96T
EUR 673
  • Should the Human MutL Homolog 1 (MLH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human MutL Homolog 1 (MLH1) in samples from tissue homogenates, cell lysates or other biological fluids.
Human MutL Homolog 1 ELISA Kit (MLH1)
RK01858 96 Tests
EUR 521
Human MutL Homolog 1 (MLH1) ELISA Kit
RD-MLH1-Hu-48Tests 48 Tests
EUR 521
Human MutL Homolog 1 (MLH1) ELISA Kit
RD-MLH1-Hu-96Tests 96 Tests
EUR 723
Human MutL Homolog 1 (MLH1) ELISA Kit
RDR-MLH1-Hu-48Tests 48 Tests
EUR 544
Human MutL Homolog 1 (MLH1) ELISA Kit
RDR-MLH1-Hu-96Tests 96 Tests
EUR 756
Human MutL Homolog 1 (MLH1) ELISA Kit
SEJ742Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human MutL Homolog 1 (MLH1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human MutL Homolog 1 (MLH1) in tissue homogenates, cell lysates and other biological fluids.
Human MutL Homolog 1 (MLH1) ELISA Kit
SEJ742Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human MutL Homolog 1 (MLH1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human MutL Homolog 1 (MLH1) in tissue homogenates, cell lysates and other biological fluids.
Human MutL Homolog 1 (MLH1) ELISA Kit
SEJ742Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human MutL Homolog 1 (MLH1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human MutL Homolog 1 (MLH1) in tissue homogenates, cell lysates and other biological fluids.
Human MutL Homolog 1 (MLH1) ELISA Kit
SEJ742Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human MutL Homolog 1 (MLH1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human MutL Homolog 1 (MLH1) in tissue homogenates, cell lysates and other biological fluids.
Human MutL Homolog 1 (MLH1) ELISA Kit
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as MutL Homolog 1 elisa. Alternative names of the recognized antigen: COCA2
  • FCC2
  • HNPCC2
  • hMLH1
  • DNA mismatch repair protein Mlh1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human MutL Homolog 1 (MLH1) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.
ELISA kit for Human MLH1 (MutL Homolog 1)
ELK4307 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to MutL Homolog 1 (MLH1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to MutL Homolog
  • Show more
Description: A sandwich ELISA kit for detection of MutL Homolog 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
MLH1 (MutL Homolog 1)
MO47010 100 ul
EUR 349
Human MutL Homolog 1 (MLH1) CLIA Kit
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Human MutL Homolog 1 (MLH1) Protein
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
MutL Homolog 1 (MLH1) Antibody
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
MutL Homolog 1 (MLH1) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
MutL Homolog 1 (MLH1) Antibody
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.
MutL Homolog 1 (MLH1) Antibody
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
MutL Homolog 1 (MLH1) Antibody
abx012221-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.
MutL Homolog 1 (MLH1) Antibody
abx025515-100ul 100 ul
EUR 523
  • Shipped within 5-10 working days.
MutL Homolog 1 (MLH1) Antibody
abx026385-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
MutL Homolog 1 (MLH1) Antibody
abx026385-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
MutL Homolog 1 (MLH1) Antibody
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 119.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 20 ug
  • 300 µg
  • Shipped within 5-10 working days.
MutL Homolog 1 (MLH1) Antibody
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
MutL Homolog 1 (MLH1) Antibody
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.
MutL Homolog 1 (MLH1) Antibody
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
MutL Homolog 1 (MLH1) Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
MutL Homolog 1 (MLH1) Antibody
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
MutL Homolog 1 (MLH1) Antibody
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
MutL Homolog 1 (MLH1) Antibody
abx235213-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Human DNA mismatch repair protein Mlh3, MLH3 ELISA KIT
ELI-23045h 96 Tests
EUR 824
MLH3 ELISA Kit (Human) (OKCD02059)
OKCD02059 96 Wells
EUR 909
Description: Description of target: Probably involved in the repair of mismatches in DNA. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.063 ng/mL
MutL Homolog 1 (MLH1) Antibody (HRP)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
MutL Homolog 1 (MLH1) Antibody (FITC)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
MutL Homolog 1 (MLH1) Antibody (Biotin)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
MLH3 antibody
70R-5576 50 ug
EUR 467
Description: Rabbit polyclonal MLH3 antibody
MLH3 antibody
70R-33834 100 ug
EUR 327
Description: Rabbit polyclonal MLH3 antibody
MLH3 Antibody
ABD3622 100 ug
EUR 438
MLH3 Antibody
34287-100ul 100ul
EUR 252
MLH3 Antibody
34287-50ul 50ul
EUR 187
MLH3 Antibody
DF3622 200ul
EUR 304
Description: MLH3 Antibody detects endogenous levels of total MLH3.
MLH3 Antibody
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against MLH3. Recognizes MLH3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000
MLH3 Antibody
CSB-PA262280-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against MLH3. Recognizes MLH3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000
MLH3 Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against MLH3. Recognizes MLH3 from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000
mutL Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against mutL. Recognizes mutL from Escherichia coli. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
EUR 202
Human MLH3 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
MLH3 sgRNA CRISPR Lentivector (Human) (Target 3)
K1307704 1.0 ug DNA
EUR 154
DNA Mismatch Repair Protein MutL (mutL) Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
MLH3 Conjugated Antibody
C34287 100ul
EUR 397
MLH3 Polyclonal Antibody
ES5531-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MLH3 from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA
MLH3 Polyclonal Antibody
ES5531-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MLH3 from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA
MLH3 Polyclonal Antibody
ABP54532-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human MLH3 at AA rangle: 490-570
  • Applications tips:
Description: A polyclonal antibody for detection of MLH3 from Human. This MLH3 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human MLH3 at AA rangle: 490-570
MLH3 Polyclonal Antibody
ABP54532-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human MLH3 at AA rangle: 490-570
  • Applications tips:
Description: A polyclonal antibody for detection of MLH3 from Human. This MLH3 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human MLH3 at AA rangle: 490-570
MLH3 Polyclonal Antibody
ABP54532-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human MLH3 at AA rangle: 490-570
  • Applications tips:
Description: A polyclonal antibody for detection of MLH3 from Human. This MLH3 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human MLH3 at AA rangle: 490-570
MLH3 Rabbit pAb
A7796-100ul 100 ul
EUR 308
MLH3 Rabbit pAb
A7796-200ul 200 ul
EUR 459
MLH3 Rabbit pAb
A7796-20ul 20 ul
EUR 183
MLH3 Rabbit pAb
A7796-50ul 50 ul
EUR 223
MLH3 Blocking Peptide
33R-8644 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MLH3 antibody, catalog no. 70R-5576
MLH3 cloning plasmid
CSB-CL883389HU-10ug 10ug
EUR 1680
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 4290
  • Sequence: atgatcaagtgcttgtcagttgaagtacaagccaaattgcgttctggtttggccataagctccttgggccaatgtgttgaggaacttgccctcaacagtattgatgctgaagcaaaatgtgtggctgtcagggtgaatatggaaaccttccaagttcaagtgatagacaatggat
  • Show more
Description: A cloning plasmid for the MLH3 gene.
MLH3 Blocking Peptide
DF3622-BP 1mg
EUR 195
Anti-MLH3 antibody
STJ94146 200 µl
EUR 197
Description: Rabbit polyclonal to MLH3.
Anti-MLH3 antibody
STJ70213 100 µg
EUR 359
Anti-MLH3 antibody
STJ110106 100 µl
EUR 277
Description: This gene is a member of the MutL-homolog (MLH) family of DNA mismatch repair (MMR) genes. MLH genes are implicated in maintaining genomic integrity during DNA replication and after meiotic recombination. The protein encoded by this gene functions as a heterodimer with other family members. Somatic mutations in this gene frequently occur in tumors exhibiting microsatellite instability, and germline mutations have been linked to hereditary nonpolyposis colorectal cancer type 7 (HNPCC7). Several alternatively spliced transcript variants have been identified, but the full-length nature of only two transcript variants has been determined.
DNA Mismatch Repair Protein MutL (MUTL) Antibody (HRP)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
DNA Mismatch Repair Protein MutL (MUTL) Antibody (FITC)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
DNA Mismatch Repair Protein MutL (MUTL) Antibody (Biotin)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Escherichia coli DNA mismatch repair protein MutL (mutL)
  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 71.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Escherichia coli DNA mismatch repair protein MutL(mutL) expressed in E.coli
MLH3 ORF Vector (Human) (pORF)
ORF013785 1.0 ug DNA
EUR 354
FSH (Human Follicle-stimulating hormone) ELISA test
3 96T/Box Ask for price
  • Area of application: Hormone testing
Description: ELISA based test for quantitative detection of FSH (Human Follicle-stimulating hormone)
Human Chromobox Homolog 3 ELISA kit
E01C0608-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Chromobox Homolog 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Chromobox Homolog 3 ELISA kit
E01C0608-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Chromobox Homolog 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Chromobox Homolog 3 ELISA kit
E01C0608-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Chromobox Homolog 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mlh3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4603104 1.0 ug DNA
EUR 154
Mlh3 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6734904 1.0 ug DNA
EUR 154
Mlh3 3'UTR GFP Stable Cell Line
TU163241 1.0 ml Ask for price
Mlh3 3'UTR Luciferase Stable Cell Line
TU213232 1.0 ml Ask for price
MLH3 3'UTR Luciferase Stable Cell Line
TU014349 1.0 ml
EUR 2333
Mlh3 3'UTR Luciferase Stable Cell Line
TU113241 1.0 ml Ask for price
MLH3 3'UTR GFP Stable Cell Line
TU064349 1.0 ml
EUR 2333
Mlh3 3'UTR GFP Stable Cell Line
TU263232 1.0 ml Ask for price
Frit Kit
FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.
MLH3 sgRNA CRISPR Lentivector set (Human)
K1307701 3 x 1.0 ug
EUR 339
Column Packing Kit
PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.
mutL Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against mutL. Recognizes mutL from Escherichia coli. This antibody is HRP conjugated. Tested in the following application: ELISA
mutL Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against mutL. Recognizes mutL from Escherichia coli. This antibody is FITC conjugated. Tested in the following application: ELISA
mutL Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against mutL. Recognizes mutL from Escherichia coli. This antibody is Biotin conjugated. Tested in the following application: ELISA
ELISA kit for Human Tribbles homolog 3
EK5052 96 tests
EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Tribbles homolog 3 in samples from serum, plasma, tissue homogenates and other biological fluids.
Human TRIB3/ Tribbles homolog 3 ELISA Kit
E2588Hu 1 Kit
EUR 605
Human TRIB3(Tribbles homolog 3) ELISA Kit
EH2519 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q96RU7
  • Alias: TRIB3/Tribbles homolog 3(TRB-3)/p65-interacting inhibitor of NF-kappa-B/Neuronal cell death-inducible putative kinase/SINK
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml
Human CBX3(Chromobox Homolog 3) ELISA Kit
EH2768 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q13185
  • Alias: CBX3
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml
Human Dapper homolog 3, DACT3 ELISA KIT
ELI-27049h 96 Tests
EUR 824
Human Tribbles homolog 3, TRIB3 ELISA KIT
ELI-36572h 96 Tests
EUR 824
Human Nanos homolog 3, NANOS3 ELISA KIT
ELI-44795h 96 Tests
EUR 824
Human Teashirt homolog 3, TSHZ3 ELISA KIT
ELI-45768h 96 Tests
EUR 824
Human Roundabout homolog 3, ROBO3 ELISA KIT
ELI-41311h 96 Tests
EUR 824
Human Chromobox Homolog 3 (CBX3) ELISA Kit
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Slingshot Homolog 3 (SSH3) ELISA Kit
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Slit Homolog 3 (Slit3) ELISA Kit
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Notch Homolog 3 (NOTCH3) ELISA Kit
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Canopy 3 Homolog (CNPY3) ELISA Kit
abx386611-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Tribbles homolog 3 (TRIB3) ELISA Kit
abx251890-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human Chromobox Homolog 3 (CBX3) ELISA Kit
abx252146-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human Frizzled Homolog 3 (FZD3) ELISA Kit
abx250521-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human Frizzled Homolog 3 (FZD3)ELISA Kit
201-12-2371 96 tests
EUR 440
  • This Frizzled Homolog 3 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Slit Homolog 3 (Slit3)ELISA Kit
201-12-2566 96 tests
EUR 440
  • This Slit Homolog 3 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Chromobox Homolog 3 (CBX3)ELISA Kit
201-12-2896 96 tests
EUR 440
  • This Chromobox Homolog 3 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Chromobox Homolog 3 (CBX3) ELISA Kit
DLR-CBX3-Hu-48T 48T
EUR 517
  • Should the Human Chromobox Homolog 3 (CBX3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Chromobox Homolog 3 (CBX3) in samples from tissue homogenates, cell lysates or other biological fluids.

Human MLH3(MutL Homolog 3) ELISA Kit