Human NRGN(Neurogranin) ELISA Kit

Human NRGN(Neurogranin) ELISA Kit

To Order Contact us: [email protected]

Human Neurogranin (NRGN) ELISA Kit
RDR-NRGN-Hu-48Tests 48 Tests
EUR 500

Human Neurogranin (NRGN) ELISA Kit
RDR-NRGN-Hu-96Tests 96 Tests
EUR 692

Human Neurogranin (NRGN) ELISA Kit
RD-NRGN-Hu-48Tests 48 Tests
EUR 478

Human Neurogranin (NRGN) ELISA Kit
RD-NRGN-Hu-96Tests 96 Tests
EUR 662

Neurogranin (NRGN) ELISA Kit
20-abx258434
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Neurogranin (NRGN) ELISA Kit
20-abx585166
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Neurogranin(NRGN) ELISA kit
CSB-EL016081HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Neurogranin (NRGN) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Neurogranin(NRGN) ELISA kit
1-CSB-EL016081HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Neurogranin(NRGN) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Neurogranin (NRGN) ELISA Kit
20-abx152496
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Neurogranin (NRGN) ELISA Kit
abx251757-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Human NRGN(Neurogranin) ELISA Kit
EH2396 96T
EUR 567.6
  • Detection range: 78-5000 pg/ml
  • Uniprot ID: Q92686
  • Alias: NRGN/RC3/hng
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml

Human NRGN/ Neurogranin ELISA Kit
E1793Hu 1 Kit
EUR 605

Human Neurogranin, NRGN ELISA KIT
ELI-23185h 96 Tests
EUR 824

Human Neurogranin (NRGN) ELISA Kit
CEA404Hu-10x96wellstestplate 10x96-wells test plate
EUR 4273.35
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neurogranin (NRGN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Neurogranin (NRGN) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Neurogranin (NRGN) ELISA Kit
CEA404Hu-1x48wellstestplate 1x48-wells test plate
EUR 439.57
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neurogranin (NRGN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Neurogranin (NRGN) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Neurogranin (NRGN) ELISA Kit
CEA404Hu-1x96wellstestplate 1x96-wells test plate
EUR 585.1
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neurogranin (NRGN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Neurogranin (NRGN) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Neurogranin (NRGN) ELISA Kit
CEA404Hu-5x96wellstestplate 5x96-wells test plate
EUR 2332.95
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neurogranin (NRGN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Neurogranin (NRGN) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Neurogranin (NRGN) ELISA Kit
4-CEA404Hu
  • EUR 4324.00
  • EUR 2283.00
  • EUR 586.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Neurogranin elisa. Alternative names of the recognized antigen: Ng
  • NEUG
  • Protein Kinase C Substrate RC3
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Neurogranin (NRGN) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Neurogranin (NRGN) ELISA Kit
abx574312-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Human Neurogranin ELISA Kit (NRGN)
RK01963 96 Tests
EUR 521

Mouse Neurogranin(NRGN) ELISA kit
CSB-EL016081MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Neurogranin (NRGN) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Neurogranin(NRGN) ELISA kit
1-CSB-EL016081MO
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Neurogranin(NRGN) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Rat Nrgn/ Neurogranin ELISA Kit
E0697Ra 1 Kit
EUR 646

Mouse Nrgn/ Neurogranin ELISA Kit
E1057Mo 1 Kit
EUR 632

Cow Neurogranin (NRGN) ELISA Kit
abx520791-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Neurogranin (NRGN) ELISA Kit
abx520793-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Rat Neurogranin (NRGN) ELISA Kit
abx520794-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Mouse Neurogranin, Nrgn ELISA KIT
ELI-36490m 96 Tests
EUR 865

Bovine Neurogranin, NRGN ELISA KIT
ELI-39513b 96 Tests
EUR 928

Rat Neurogranin ELISA Kit (NRGN)
RK03848 96 Tests
EUR 521

Neurogranin (NRGN) CLIA Kit
20-abx491457
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Neurogranin (NRGN) Antibody
20-abx006154
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Neurogranin (NRGN) Antibody
20-abx177756
  • EUR 1107.00
  • EUR 537.00
  • 1 mg
  • 200 ug
  • Please enquire.

Neurogranin (NRGN) Antibody
20-abx173771
  • EUR 314.00
  • EUR 787.00
  • EUR 411.00
  • EUR 154.00
  • EUR 258.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-12 working days.

Neurogranin (NRGN) Antibody
20-abx242298
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Neurogranin (NRGN) Antibody
abx235676-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

ELISA kit for Human NRGN (Neurogranin)
ELK3321 1 plate of 96 wells
EUR 432
  • A monoclonal antibody specific to Neurogranin (NRGN) has been pre-coated onto a microplate. A competitive inhibition reaction is launched between biotin labeled Neurogranin (NRGN) and unlabeled Neurogranin (NRGN) (Standards or samples) with the pre-c
  • Show more
Description: A competitive Inhibition ELISA kit for detection of Neurogranin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human NRGN (Neurogranin)
ELK7646 1 plate of 96 wells
EUR 372
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Neurogranin (NRGN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Neurogranin (NR
  • Show more
Description: A sandwich ELISA kit for detection of Neurogranin from Human,Mouse,Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Neurogranin (NRGN) CLIA Kit
20-abx490088
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Neurogranin (NRGN) Protein
20-abx654515
  • EUR 523.00
  • EUR 244.00
  • EUR 1497.00
  • EUR 606.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Human Neurogranin (NRGN) Protein
20-abx262390
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

Multi-species Neurogranin (NRGN) ELISA Kit
CEA404Mi-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Multi-species Neurogranin (NRGN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Multi-species Neurogranin (NRGN) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Multi-species Neurogranin (NRGN) ELISA Kit
CEA404Mi-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Multi-species Neurogranin (NRGN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Multi-species Neurogranin (NRGN) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Multi-species Neurogranin (NRGN) ELISA Kit
CEA404Mi-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Multi-species Neurogranin (NRGN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Multi-species Neurogranin (NRGN) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Multi-species Neurogranin (NRGN) ELISA Kit
CEA404Mi-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Multi-species Neurogranin (NRGN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Multi-species Neurogranin (NRGN) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Multi-species Neurogranin (NRGN) ELISA Kit
4-CEA404Mi
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Neurogranin elisa. Alternative names of the recognized antigen: Ng
  • NEUG
  • Protein Kinase C Substrate RC3
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Multi-species Neurogranin (NRGN) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Rat Neurogranin (NRGN)
KTE101185-48T 48T
EUR 354
Description: Quantitative sandwich ELISA for measuring Rat Neurogranin (NRGN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Neurogranin (NRGN)
KTE101185-5platesof96wells 5 plates of 96 wells
EUR 2252
Description: Quantitative sandwich ELISA for measuring Rat Neurogranin (NRGN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Neurogranin (NRGN)
KTE101185-96T 96T
EUR 572
Description: Quantitative sandwich ELISA for measuring Rat Neurogranin (NRGN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Multi-species Neurogranin (NRGN) ELISA Kit
SEA404Mi-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Multi-species Neurogranin (NRGN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Multi-species Neurogranin (NRGN) in tissue homogenates, cell lysates and other biological fluids.

Multi-species Neurogranin (NRGN) ELISA Kit
SEA404Mi-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Multi-species Neurogranin (NRGN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Multi-species Neurogranin (NRGN) in tissue homogenates, cell lysates and other biological fluids.

Multi-species Neurogranin (NRGN) ELISA Kit
SEA404Mi-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Multi-species Neurogranin (NRGN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Multi-species Neurogranin (NRGN) in tissue homogenates, cell lysates and other biological fluids.

Multi-species Neurogranin (NRGN) ELISA Kit
SEA404Mi-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Multi-species Neurogranin (NRGN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Multi-species Neurogranin (NRGN) in tissue homogenates, cell lysates and other biological fluids.

Multi-species Neurogranin (NRGN) ELISA Kit
4-SEA404Mi
  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Neurogranin elisa. Alternative names of the recognized antigen: Ng
  • NEUG
  • Protein Kinase C Substrate RC3
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Multi-species Neurogranin (NRGN) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Nrgn ELISA Kit| Rat Neurogranin ELISA Kit
EF019049 96 Tests
EUR 689

Nrgn ELISA Kit| Mouse Neurogranin ELISA Kit
EF015658 96 Tests
EUR 689

NRGN ELISA Kit| Bovine Neurogranin ELISA Kit
EF011658 96 Tests
EUR 689

Neurogranin (NRGN) Monoclonal Antibody (Human)
4-MAA404Hu22
  • EUR 241.00
  • EUR 2417.00
  • EUR 604.00
  • EUR 301.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Neurogranin (NRGN)

NRGN Neurogranin Human Recombinant Protein
PROTQ92686 Regular: 10ug
EUR 317
Description: NRGN Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 101 amino acids (1-78 a.a.) and having a molecular mass of 10.0kDa (molecular size on SDS-PAGE will appear higher). ;NRGN is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

ELISA kit for Mouse Neurogranin (NRGN)  Kit
KTE71596-48T 48T
EUR 354
Description: Quantitative sandwich ELISA for measuring Mouse Neurogranin (NRGN)  Kit in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Neurogranin (NRGN)  Kit
KTE71596-5platesof96wells 5 plates of 96 wells
EUR 2252
Description: Quantitative sandwich ELISA for measuring Mouse Neurogranin (NRGN)  Kit in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Neurogranin (NRGN)  Kit
KTE71596-96T 96T
EUR 572
Description: Quantitative sandwich ELISA for measuring Mouse Neurogranin (NRGN)  Kit in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Polyclonal NRGN / Neurogranin Antibody (Internal)
AMM06825G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human NRGN / Neurogranin (Internal). This antibody is tested and proven to work in the following applications:

Neurogranin (NRGN) Monoclonal Antibody (Human), APC
4-MAA404Hu22-APC
  • EUR 336.00
  • EUR 3149.00
  • EUR 881.00
  • EUR 427.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Neurogranin (NRGN). This antibody is labeled with APC.

Neurogranin (NRGN) Monoclonal Antibody (Human), Biotinylated
4-MAA404Hu22-Biotin
  • EUR 305.00
  • EUR 2367.00
  • EUR 704.00
  • EUR 371.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Neurogranin (NRGN). This antibody is labeled with Biotin.

Neurogranin (NRGN) Monoclonal Antibody (Human), Cy3
4-MAA404Hu22-Cy3
  • EUR 407.00
  • EUR 4157.00
  • EUR 1133.00
  • EUR 528.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Neurogranin (NRGN). This antibody is labeled with Cy3.

Neurogranin (NRGN) Monoclonal Antibody (Human), FITC
4-MAA404Hu22-FITC
  • EUR 289.00
  • EUR 2539.00
  • EUR 724.00
  • EUR 361.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Neurogranin (NRGN). This antibody is labeled with FITC.

Neurogranin (NRGN) Monoclonal Antibody (Human), HRP
4-MAA404Hu22-HRP
  • EUR 308.00
  • EUR 2745.00
  • EUR 780.00
  • EUR 387.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Neurogranin (NRGN). This antibody is labeled with HRP.

Neurogranin (NRGN) Monoclonal Antibody (Human), PE
4-MAA404Hu22-PE
  • EUR 289.00
  • EUR 2539.00
  • EUR 724.00
  • EUR 361.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Neurogranin (NRGN). This antibody is labeled with PE.

Neurogranin (NRGN) Monoclonal Antibody (Human), APC-Cy7
4-MAA404Hu22-APC-Cy7
  • EUR 553.00
  • EUR 6178.00
  • EUR 1642.00
  • EUR 734.00
  • EUR 311.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Neurogranin (NRGN). This antibody is labeled with APC-Cy7.

Nrgn/ Rat Nrgn ELISA Kit
ELI-23186r 96 Tests
EUR 886

Human NRGN ELISA Kit
ELA-E8816h 96 Tests
EUR 824

NRGN ELISA KIT|Human
EF006445 96 Tests
EUR 689

ELISA kit for Human Neurogranin
EK4821 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Neurogranin in samples from serum, plasma, tissue homogenates and other biological fluids.

Neurogranin
PR27174 10 ug
EUR 318

Human Neurogranin (NRG
QY-E05326 96T
EUR 361

Neurogranin precursor
GT41024 100 ug
EUR 487

Neurogranin precursor
P41019 100 ug Blocking Peptide
EUR 239

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202

NRGN antibody
70R-18965 50 ul
EUR 435
Description: Rabbit polyclonal NRGN antibody

NRGN Antibody
35545-100ul 100ul
EUR 252

NRGN Antibody
1-CSB-PA793948
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NRGN. Recognizes NRGN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

NRGN Antibody
1-CSB-PA016081GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against NRGN. Recognizes NRGN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

NRGN siRNA
20-abx903658
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NRGN siRNA
20-abx926396
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NRGN siRNA
20-abx926397
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pENTR223-NRGN
PVT12314 2 ug
EUR 391

Human NRGN shRNA Plasmid
20-abx953256
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Neurogranin (28-43)
5-01591 4 x 1mg Ask for price

Neurogranin precursor Antibody
abx432061-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

anti- Neurogranin antibody
FNab05676 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • IHC: 1:20-1:200
  • IP: 1:500-1:2000
  • Immunogen: neurogranin(protein kinase C substrate, RC3)
  • Uniprot ID: Q92686
  • Research Area: Neuroscience, Signal Transduction, Developmental biology
Description: Antibody raised against Neurogranin

Anti-Neurogranin antibody
PAab05676 100 ug
EUR 355

NRGN Conjugated Antibody
C35545 100ul
EUR 397

NRGN cloning plasmid
CSB-CL849776HU-10ug 10ug
EUR 185
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 237
  • Sequence: atggactgctgcaccgagaacgcctgctccaagccggacgacgacattctagacatcccgctggacgatcccggcgccaacgcggccgccgccaaaatccaggcgagttttcggggccacatggcgcggaagaagataaagagcggagagcgcggccggaagggcccgggccctgg
  • Show more
Description: A cloning plasmid for the NRGN gene.

NRGN Rabbit pAb
A8444-100ul 100 ul
EUR 308

NRGN Rabbit pAb
A8444-200ul 200 ul
EUR 459

NRGN Rabbit pAb
A8444-20ul 20 ul
EUR 183

NRGN Rabbit pAb
A8444-50ul 50 ul
EUR 223

Anti-NRGN antibody
STJ110742 100 µl
EUR 277
Description: Neurogranin (NRGN) is the human homolog of the neuron-specific rat RC3/neurogranin gene. This gene encodes a postsynaptic protein kinase substrate that binds calmodulin in the absence of calcium. The NRGN gene contains four exons and three introns. The exons 1 and 2 encode the protein and exons 3 and 4 contain untranslated sequences. It is suggested that the NRGN is a direct target for thyroid hormone in human brain, and that control of expression of this gene could underlay many of the consequences of hypothyroidism on mental states during development as well as in adult subjects.

NRGN ORF Vector (Human) (pORF)
ORF007219 1.0 ug DNA
EUR 95

Anti-Neurogranin precursor Antibody
A05781 100ug/200ul
EUR 397
Description: Goat Polyclonal Neurogranin precursor Antibody. Validated in IHC and tested in Human, Mouse.

Neurogranin precursor Antibody (Biotin)
abx433025-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Anti-Neurogranin precursor antibody
STJ72056 100 µg
EUR 359

Frit Kit
FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Human NRGN(Neurogranin) ELISA Kit