Rat DIABLO(Diablo Homolog) ELISA Kit
To Order Contact us: [email protected]
Human Diablo Homolog (DIABLO) ELISA Kit |
RD-DIABLO-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Rat Diablo Homolog ELISA Kit (DIABLO) |
RK03615 |
Abclonal |
96 Tests |
EUR 521 |
Rat Diablo Homolog (DIABLO) ELISA Kit |
SEJ266Ra-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5124.2 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Diablo Homolog (DIABLO) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Diablo Homolog (DIABLO) in tissue homogenates, cell lysates and other biological fluids. |
Rat Diablo Homolog (DIABLO) ELISA Kit |
SEJ266Ra-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 509.64 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Diablo Homolog (DIABLO) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Diablo Homolog (DIABLO) in tissue homogenates, cell lysates and other biological fluids. |
Rat Diablo Homolog (DIABLO) ELISA Kit |
SEJ266Ra-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 685.2 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Diablo Homolog (DIABLO) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Diablo Homolog (DIABLO) in tissue homogenates, cell lysates and other biological fluids. |
Rat Diablo Homolog (DIABLO) ELISA Kit |
SEJ266Ra-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2783.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Diablo Homolog (DIABLO) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Diablo Homolog (DIABLO) in tissue homogenates, cell lysates and other biological fluids. |
Rat Diablo Homolog (DIABLO) ELISA Kit |
4-SEJ266Ra |
Cloud-Clone |
-
EUR 5175.00
-
EUR 2734.00
-
EUR 686.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Diablo Homolog elisa. Alternative names of the recognized antigen: SMAC
- DIABLO-S
- Direct IAP-binding protein with low pI
- Second mitochondria-derived activator of caspase
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Diablo Homolog (DIABLO) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Rat Diablo Homolog (DIABLO) Protein |
20-abx653172 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
ELISA kit for Rat DIABLO (Diablo Homolog) |
ELK7379 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Diablo Homolog (DIABLO). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Diablo Hom
- Show more
|
Description: A sandwich ELISA kit for detection of Diablo Homolog from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Human Diablo Homolog (DIABLO) ELISA Kit |
20-abx151312 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Diablo Homolog (DIABLO) ELISA Kit |
SEJ266Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Diablo Homolog (DIABLO) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Diablo Homolog (DIABLO) in Tissue homogenates, cell lysates and other biological fluids. |
Human Diablo Homolog (DIABLO) ELISA Kit |
SEJ266Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Diablo Homolog (DIABLO) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Diablo Homolog (DIABLO) in Tissue homogenates, cell lysates and other biological fluids. |
Human Diablo Homolog (DIABLO) ELISA Kit |
SEJ266Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Diablo Homolog (DIABLO) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Diablo Homolog (DIABLO) in Tissue homogenates, cell lysates and other biological fluids. |
Human Diablo Homolog (DIABLO) ELISA Kit |
SEJ266Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Diablo Homolog (DIABLO) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Diablo Homolog (DIABLO) in Tissue homogenates, cell lysates and other biological fluids. |
Human Diablo Homolog (DIABLO) ELISA Kit |
4-SEJ266Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Diablo Homolog elisa. Alternative names of the recognized antigen: SMAC
- DIABLO-S
- Direct IAP-binding protein with low pI
- Second mitochondria-derived activator of caspase
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Diablo Homolog (DIABLO) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Diablo Homolog (DIABLO) Antibody |
20-abx112053 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Diablo Homolog (DIABLO) Antibody |
20-abx172105 |
Abbexa |
|
|
|
Diablo Homolog (DIABLO) Antibody |
20-abx172106 |
Abbexa |
|
|
|
Diablo Homolog (DIABLO) Antibody |
20-abx176157 |
Abbexa |
|
|
|
Diablo Homolog (DIABLO) Antibody |
20-abx176158 |
Abbexa |
|
|
|
Diablo Homolog (DIABLO) Antibody |
20-abx333841 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Diablo Homolog (DIABLO) Antibody |
20-abx212475 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Diablo Homolog (DIABLO) Antibody |
20-abx212504 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Human Diablo homolog, mitochondrial, DIABLO ELISA KIT |
ELI-25841h |
Lifescience Market |
96 Tests |
EUR 824 |
ELISA kit for Human DIABLO (Diablo Homolog) |
ELK4816 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Diablo Homolog (DIABLO). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Diablo Hom
- Show more
|
Description: A sandwich ELISA kit for detection of Diablo Homolog from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Mouse Diablo homolog, mitochondrial, Diablo ELISA KIT |
ELI-48369m |
Lifescience Market |
96 Tests |
EUR 865 |
Human Diablo Homolog (DIABLO) CLIA Kit |
20-abx495657 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Human Diablo Homolog (DIABLO) Protein |
20-abx653171 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Diablo homolog (DIABLO) polyclonal antibody |
ABP-PAB-10267 |
Allele Biotech |
100 ug |
Ask for price |
- Product line: Apoptosis
- Brand:
|
Diablo Homolog (DIABLO) Antibody (HRP) |
20-abx335325 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Diablo Homolog (DIABLO) Antibody (FITC) |
20-abx335326 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Diablo Homolog (DIABLO) Antibody (Biotin) |
20-abx335327 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
ELISA kit for Mouse Diablo homolog, mitochondrial (DIABLO) |
KTE71285-48T |
Abbkine |
48T |
EUR 332 |
- DIABLO encodes an inhibitor of apoptosis protein (IAP)-binding protein. The encoded mitochondrial protein enters the cytosol when cells undergo apoptosis, and allows activation of caspases by binding to inhibitor of apoptosis proteins. Overexpression
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Diablo homolog, mitochondrial (DIABLO) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Diablo homolog, mitochondrial (DIABLO) |
KTE71285-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- DIABLO encodes an inhibitor of apoptosis protein (IAP)-binding protein. The encoded mitochondrial protein enters the cytosol when cells undergo apoptosis, and allows activation of caspases by binding to inhibitor of apoptosis proteins. Overexpression
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Diablo homolog, mitochondrial (DIABLO) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Diablo homolog, mitochondrial (DIABLO) |
KTE71285-96T |
Abbkine |
96T |
EUR 539 |
- DIABLO encodes an inhibitor of apoptosis protein (IAP)-binding protein. The encoded mitochondrial protein enters the cytosol when cells undergo apoptosis, and allows activation of caspases by binding to inhibitor of apoptosis proteins. Overexpression
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Diablo homolog, mitochondrial (DIABLO) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Diablo homolog, mitochondrial (DIABLO) |
KTE62061-48T |
Abbkine |
48T |
EUR 332 |
- DIABLO encodes an inhibitor of apoptosis protein (IAP)-binding protein. The encoded mitochondrial protein enters the cytosol when cells undergo apoptosis, and allows activation of caspases by binding to inhibitor of apoptosis proteins. Overexpression
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Diablo homolog, mitochondrial (DIABLO) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Diablo homolog, mitochondrial (DIABLO) |
KTE62061-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- DIABLO encodes an inhibitor of apoptosis protein (IAP)-binding protein. The encoded mitochondrial protein enters the cytosol when cells undergo apoptosis, and allows activation of caspases by binding to inhibitor of apoptosis proteins. Overexpression
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Diablo homolog, mitochondrial (DIABLO) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Diablo homolog, mitochondrial (DIABLO) |
KTE62061-96T |
Abbkine |
96T |
EUR 539 |
- DIABLO encodes an inhibitor of apoptosis protein (IAP)-binding protein. The encoded mitochondrial protein enters the cytosol when cells undergo apoptosis, and allows activation of caspases by binding to inhibitor of apoptosis proteins. Overexpression
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Diablo homolog, mitochondrial (DIABLO) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
DIABLO |
E541-004 |
EnoGene |
100ug |
EUR 343 |
DIABLO ELISA Kit (Rat) (OKCD04273) |
OKCD04273 |
Aviva Systems Biology |
96 Wells |
EUR 936 |
Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.063 ng/mL |
DIABLO siRNA |
20-abx914146 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DIABLO siRNA |
20-abx914147 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DIABLO antibody |
70R-DR008 |
Fitzgerald |
100 ug |
EUR 300 |
Description: Affinity purified Rabbit polyclonal DIABLO antibody |
DIABLO Antibody |
48991-100ul |
SAB |
100ul |
EUR 333 |
DIABLO Antibody |
48991-50ul |
SAB |
50ul |
EUR 239 |
DIABLO Antibody |
31125-100ul |
SAB |
100ul |
EUR 252 |
DIABLO Antibody |
31125-50ul |
SAB |
50ul |
EUR 187 |
DIABLO Antibody |
32716-100ul |
SAB |
100ul |
EUR 252 |
DIABLO antibody |
20R-1288 |
Fitzgerald |
100 ug |
EUR 377 |
Description: Rabbit polyclonal DIABLO antibody |
Diablo antibody |
20R-2899 |
Fitzgerald |
100 ul |
EUR 393 |
Description: Rabbit polyclonal Diablo antibody |
DIABLO antibody |
70R-16834 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal DIABLO antibody |
DIABLO Antibody |
DF7017 |
Affbiotech |
200ul |
EUR 304 |
Description: DIABLO Antibody detects endogenous levels of total DIABLO. |
DIABLO Antibody |
1-CSB-PA966330 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against DIABLO. Recognizes DIABLO from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:50-1:200 |
DIABLO Antibody |
1-CSB-PA006888GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against DIABLO. Recognizes DIABLO from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
DIABLO Antibody |
1-CSB-PA592293 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against DIABLO. Recognizes DIABLO from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:100-1:300 |
DIABLO Antibody |
1-CSB-PA865113LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against DIABLO. Recognizes DIABLO from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200 |
anti-DIABLO |
YF-PA27589 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to DIABLO |
DIABLO Recombinant Protein (Rat) |
RP198050 |
ABM |
100 ug |
Ask for price |
Anserini Smac/DIABLO ELISA Kit |
EAS0020 |
Abclonal |
96Tests |
EUR 521 |
Human Diablo/SMAC ELISA Kit |
LF-EK50928 |
Abfrontier |
1×96T |
EUR 648 |
DIABLO ELISA Kit (Human) (OKCD09174) |
OKCD09174 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
Description: Description of target: This gene encodes an inhibitor of apoptosis protein (IAP)-binding protein. The encoded mitochondrial protein enters the cytosol when cells undergo apoptosis, and allows activation of caspases by binding to inhibitor of apoptosis proteins. Overexpression of the encoded protein sensitizes tumor cells to apoptosis. A mutation in this gene is associated with young-adult onset of nonsyndromic deafness-64. Alternative splicing results in multiple transcript variants encoding different isoforms.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.056ng/mL |
DIABLO Conjugated Antibody |
C48991 |
SAB |
100ul |
EUR 397 |
DIABLO Conjugated Antibody |
C32716 |
SAB |
100ul |
EUR 397 |
DIABLO Conjugated Antibody |
C31125 |
SAB |
100ul |
EUR 397 |
anti- DIABLO antibody |
FNab02384 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:500-1:2000
- IP: 1:500-1:1000
- IHC: 1:20-1:200
- Immunogen: diablo homolog(Drosophila)
- Uniprot ID: Q9NR28
- Gene ID: 56616
- Research Area: Cancer
|
Description: Antibody raised against DIABLO |
SMAC / DIABLO Antibody |
20-abx137470 |
Abbexa |
-
EUR 704.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
Human DIABLO Protein |
abx060001-100ug |
Abbexa |
100 ug |
EUR 328 |
- Shipped within 5-10 working days.
|
Smac / DIABLO Antibody |
abx037649-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
SMAC / DIABLO Protein |
20-abx262000 |
Abbexa |
-
EUR 4490.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
DIABLO Rabbit pAb |
A0853-100ul |
Abclonal |
100 ul |
EUR 308 |
DIABLO Rabbit pAb |
A0853-200ul |
Abclonal |
200 ul |
EUR 459 |
DIABLO Rabbit pAb |
A0853-20ul |
Abclonal |
20 ul |
Ask for price |
DIABLO Rabbit pAb |
A0853-50ul |
Abclonal |
50 ul |
Ask for price |
DIABLO Rabbit pAb |
A13432-100ul |
Abclonal |
100 ul |
EUR 308 |
DIABLO Rabbit pAb |
A13432-200ul |
Abclonal |
200 ul |
EUR 459 |
DIABLO Rabbit pAb |
A13432-20ul |
Abclonal |
20 ul |
EUR 183 |
DIABLO Rabbit pAb |
A13432-50ul |
Abclonal |
50 ul |
EUR 223 |
DIABLO Rabbit pAb |
A2564-100ul |
Abclonal |
100 ul |
EUR 308 |
DIABLO Rabbit pAb |
A2564-200ul |
Abclonal |
200 ul |
EUR 459 |
DIABLO Rabbit pAb |
A2564-20ul |
Abclonal |
20 ul |
EUR 183 |
DIABLO Rabbit pAb |
A2564-50ul |
Abclonal |
50 ul |
EUR 223 |
DIABLO Blocking Peptide |
33R-5520 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DIABLO antibody, catalog no. 20R-1288 |
Smac/DIABLO Antibody |
39330-100ul |
SAB |
100ul |
EUR 390 |
Smac/DIABLO Antibody |
3298-100 |
Biovision |
|
EUR 316 |
Smac/DIABLO Antibody |
3298-30T |
Biovision |
|
EUR 146 |
DIABLO cloning plasmid |
CSB-CL865113HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 720
- Sequence: atggcggctctgaagagttggctgtcgcgcagcgtaacttcattcttcaggtacagacagtgtttgtgtgttcctgttgtggctaactttaagaagcggtgtttctcagaattgataagaccatggcacaaaactgtgacgattggctttggagtaaccctgtgtgcggttcctat
- Show more
|
Description: A cloning plasmid for the DIABLO gene. |
DIABLO Blocking Peptide |
DF7017-BP |
Affbiotech |
1mg |
EUR 195 |
anti-Smac/Diablo |
LF-PA0045 |
Abfrontier |
100 ul |
EUR 334 |
Description: Rabbit polyclonal to Smac/Diablo |
Anti-DIABLO antibody |
STJ111037 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes an inhibitor of apoptosis protein (IAP)-binding protein. The encoded mitochondrial protein enters the cytosol when cells undergo apoptosis, and allows activation of caspases by binding to inhibitor of apoptosis proteins. Overexpression of the encoded protein sensitizes tumor cells to apoptosis. A mutation in this gene is associated with young-adult onset of nonsyndromic deafness-64. Alternative splicing results in multiple transcript variants encoding different isoforms. |
Anti-DIABLO antibody |
STJ23380 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes an inhibitor of apoptosis protein (IAP)-binding protein. The encoded mitochondrial protein enters the cytosol when cells undergo apoptosis, and allows activation of caspases by binding to inhibitor of apoptosis proteins. Overexpression of the encoded protein sensitizes tumor cells to apoptosis. A mutation in this gene is associated with young-adult onset of nonsyndromic deafness-64. Alternative splicing results in multiple transcript variants encoding different isoforms. |
Anti-DIABLO antibody |
STJ115393 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes an inhibitor of apoptosis protein (IAP)-binding protein. The encoded mitochondrial protein enters the cytosol when cells undergo apoptosis, and allows activation of caspases by binding to inhibitor of apoptosis proteins. Overexpression of the encoded protein sensitizes tumor cells to apoptosis. A mutation in this gene is associated with young-adult onset of nonsyndromic deafness-64. Alternative splicing results in multiple transcript variants encoding different isoforms. |
anti-Smac / Diablo |
YF-PA20009 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to Smac / Diablo |
anti-Smac / Diablo |
YF-PA20010 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to Smac / Diablo |
Diablo ORF Vector (Rat) (pORF) |
ORF066018 |
ABM |
1.0 ug DNA |
EUR 506 |
ELISA kit for Human Diablo/SMAC |
EK5376 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Diablo/SMAC in samples from serum, plasma, tissue homogenates and other biological fluids. |
Human Diablo/SMAC PicoKine ELISA Kit |
EK0838 |
BosterBio |
96 wells |
EUR 425 |
Description: For quantitative detection of human Diablo in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA). |
Diablo/SMAC ELISA Kit (Human) (OKBB00448) |
OKBB00448 |
Aviva Systems Biology |
96 Wells |
EUR 505 |
Description: Description of target: Diablo homolog, mitochondrial, also known as second mitochondria-derived activator of caspases (SMAC), is a protein that in humans is encoded by the DIABLO gene (direct IAP binding protein with low pI). It is mapped to 12q24.31. DIABLO can bind mammalian IAP homolog A (MIHA, or API3) and can also interact with MIHB, MIHC, and OpIAP, the baculoviral IAP. This gene encodes an inhibitor of apoptosis protein (IAP)-binding protein. The encoded mitochondrial protein enters the cytosol when cells undergo apoptosis, and allows activation of caspases by binding to inhibitor of apoptosis proteins. Over expression of the encoded protein sensitizes tumor cells to apoptosis. A mutation in this gene is associated with young-adult onset of nonsyndromic deafness-64.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: <= 10 pg/mL |
Polyclonal Smac/DIABLO Antibody |
APR00062G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Smac/DIABLO . This antibody is tested and proven to work in the following applications: |
Mouse DIABLO shRNA Plasmid |
20-abx975688 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rat DIABLO(Diablo Homolog) ELISA Kit