Rat DIABLO(Diablo Homolog) ELISA Kit

Rat DIABLO(Diablo Homolog) ELISA Kit

To Order Contact us: [email protected]

Human Diablo Homolog (DIABLO) ELISA Kit

RD-DIABLO-Hu-96Tests 96 Tests
EUR 723

Rat Diablo Homolog (DIABLO) ELISA Kit

SEJ266Ra-10x96wellstestplate 10x96-wells test plate
EUR 5124.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Diablo Homolog (DIABLO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Diablo Homolog (DIABLO) in tissue homogenates, cell lysates and other biological fluids.

Rat Diablo Homolog (DIABLO) ELISA Kit

SEJ266Ra-1x48wellstestplate 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Diablo Homolog (DIABLO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Diablo Homolog (DIABLO) in tissue homogenates, cell lysates and other biological fluids.

Rat Diablo Homolog (DIABLO) ELISA Kit

SEJ266Ra-1x96wellstestplate 1x96-wells test plate
EUR 685.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Diablo Homolog (DIABLO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Diablo Homolog (DIABLO) in tissue homogenates, cell lysates and other biological fluids.

Rat Diablo Homolog (DIABLO) ELISA Kit

SEJ266Ra-5x96wellstestplate 5x96-wells test plate
EUR 2783.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Diablo Homolog (DIABLO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Diablo Homolog (DIABLO) in tissue homogenates, cell lysates and other biological fluids.

Rat Diablo Homolog (DIABLO) ELISA Kit

  • EUR 5175.00
  • EUR 2734.00
  • EUR 686.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Diablo Homolog elisa. Alternative names of the recognized antigen: SMAC
  • Direct IAP-binding protein with low pI
  • Second mitochondria-derived activator of caspase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Diablo Homolog (DIABLO) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Diablo Homolog ELISA Kit (DIABLO)

RK03615 96 Tests
EUR 521

Rat Diablo Homolog (DIABLO) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Diablo Homolog (DIABLO) Antibody

  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Diablo Homolog (DIABLO) Antibody

  • EUR 1302.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.

Diablo Homolog (DIABLO) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Diablo Homolog (DIABLO) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Diablo Homolog (DIABLO) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Diablo Homolog (DIABLO) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Diablo Homolog (DIABLO) Antibody

  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Diablo Homolog (DIABLO) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ELISA kit for Rat DIABLO (Diablo Homolog)

ELK7379 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Diablo Homolog (DIABLO). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Diablo Hom
  • Show more
Description: A sandwich ELISA kit for detection of Diablo Homolog from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Diablo Homolog (DIABLO) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Diablo Homolog (DIABLO) ELISA Kit

SEJ266Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Diablo Homolog (DIABLO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Diablo Homolog (DIABLO) in Tissue homogenates, cell lysates and other biological fluids.

Human Diablo Homolog (DIABLO) ELISA Kit

SEJ266Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Diablo Homolog (DIABLO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Diablo Homolog (DIABLO) in Tissue homogenates, cell lysates and other biological fluids.

Human Diablo Homolog (DIABLO) ELISA Kit

SEJ266Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Diablo Homolog (DIABLO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Diablo Homolog (DIABLO) in Tissue homogenates, cell lysates and other biological fluids.

Human Diablo Homolog (DIABLO) ELISA Kit

SEJ266Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Diablo Homolog (DIABLO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Diablo Homolog (DIABLO) in Tissue homogenates, cell lysates and other biological fluids.

Human Diablo Homolog (DIABLO) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Diablo Homolog elisa. Alternative names of the recognized antigen: SMAC
  • Direct IAP-binding protein with low pI
  • Second mitochondria-derived activator of caspase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Diablo Homolog (DIABLO) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Diablo Homolog (DIABLO) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Diablo Homolog (DIABLO) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Diablo Homolog (DIABLO) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human Diablo Homolog (DIABLO) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Diablo homolog (DIABLO) polyclonal antibody

ABP-PAB-10267 100 ug Ask for price
    • Product line: Apoptosis
    • Brand:

Human Diablo Homolog (DIABLO) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Diablo homolog, mitochondrial, DIABLO ELISA KIT

ELI-25841h 96 Tests
EUR 824

ELISA kit for Human DIABLO (Diablo Homolog)

ELK4816 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Diablo Homolog (DIABLO). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Diablo Hom
  • Show more
Description: A sandwich ELISA kit for detection of Diablo Homolog from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Mouse Diablo homolog, mitochondrial, Diablo ELISA KIT

ELI-48369m 96 Tests
EUR 865

ELISA kit for Mouse Diablo homolog, mitochondrial (DIABLO)

KTE71285-48T 48T
EUR 332
  • DIABLO encodes an inhibitor of apoptosis protein (IAP)-binding protein. The encoded mitochondrial protein enters the cytosol when cells undergo apoptosis, and allows activation of caspases by binding to inhibitor of apoptosis proteins. Overexpression
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Diablo homolog, mitochondrial (DIABLO) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Diablo homolog, mitochondrial (DIABLO)

KTE71285-5platesof96wells 5 plates of 96 wells
EUR 2115
  • DIABLO encodes an inhibitor of apoptosis protein (IAP)-binding protein. The encoded mitochondrial protein enters the cytosol when cells undergo apoptosis, and allows activation of caspases by binding to inhibitor of apoptosis proteins. Overexpression
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Diablo homolog, mitochondrial (DIABLO) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Diablo homolog, mitochondrial (DIABLO)

KTE71285-96T 96T
EUR 539
  • DIABLO encodes an inhibitor of apoptosis protein (IAP)-binding protein. The encoded mitochondrial protein enters the cytosol when cells undergo apoptosis, and allows activation of caspases by binding to inhibitor of apoptosis proteins. Overexpression
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Diablo homolog, mitochondrial (DIABLO) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Diablo homolog, mitochondrial (DIABLO)

KTE62061-48T 48T
EUR 332
  • DIABLO encodes an inhibitor of apoptosis protein (IAP)-binding protein. The encoded mitochondrial protein enters the cytosol when cells undergo apoptosis, and allows activation of caspases by binding to inhibitor of apoptosis proteins. Overexpression
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Diablo homolog, mitochondrial (DIABLO) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Diablo homolog, mitochondrial (DIABLO)

KTE62061-5platesof96wells 5 plates of 96 wells
EUR 2115
  • DIABLO encodes an inhibitor of apoptosis protein (IAP)-binding protein. The encoded mitochondrial protein enters the cytosol when cells undergo apoptosis, and allows activation of caspases by binding to inhibitor of apoptosis proteins. Overexpression
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Diablo homolog, mitochondrial (DIABLO) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Diablo homolog, mitochondrial (DIABLO)

KTE62061-96T 96T
EUR 539
  • DIABLO encodes an inhibitor of apoptosis protein (IAP)-binding protein. The encoded mitochondrial protein enters the cytosol when cells undergo apoptosis, and allows activation of caspases by binding to inhibitor of apoptosis proteins. Overexpression
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Diablo homolog, mitochondrial (DIABLO) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.


E541-004 100ug
EUR 343

DIABLO antibody

20R-1288 100 ug
EUR 377
Description: Rabbit polyclonal DIABLO antibody

Diablo antibody

20R-2899 100 ul
EUR 393
Description: Rabbit polyclonal Diablo antibody

DIABLO Antibody

31125-100ul 100ul
EUR 252

DIABLO Antibody

31125-50ul 50ul
EUR 187

DIABLO antibody

70R-16834 50 ul
EUR 435
Description: Rabbit polyclonal DIABLO antibody

DIABLO Antibody

32716-100ul 100ul
EUR 252

DIABLO Antibody

48991-100ul 100ul
EUR 333

DIABLO Antibody

48991-50ul 50ul
EUR 239

DIABLO Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against DIABLO. Recognizes DIABLO from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:50-1:200

DIABLO Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DIABLO. Recognizes DIABLO from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

DIABLO Antibody

DF7017 200ul
EUR 304
Description: DIABLO Antibody detects endogenous levels of total DIABLO.

DIABLO Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against DIABLO. Recognizes DIABLO from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:100-1:300

DIABLO Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against DIABLO. Recognizes DIABLO from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

DIABLO antibody

70R-DR008 100 ug
EUR 300
Description: Affinity purified Rabbit polyclonal DIABLO antibody


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DIABLO Antibody

ABD7017 100 ug
EUR 438


YF-PA27589 50 ug
EUR 363
Description: Mouse polyclonal to DIABLO

DIABLO ELISA Kit (Rat) (OKCD04273)

OKCD04273 96 Wells
EUR 936
Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.063 ng/mL


EF009108 96 Tests
EUR 689

DIABLO Recombinant Protein (Rat)

RP198050 100 ug Ask for price

DIABLO Rabbit pAb

A0853-100ul 100 ul
EUR 308

DIABLO Rabbit pAb

A0853-200ul 200 ul
EUR 459

DIABLO Rabbit pAb

A0853-20ul 20 ul Ask for price

DIABLO Rabbit pAb

A0853-50ul 50 ul Ask for price

DIABLO Rabbit pAb

A13432-100ul 100 ul
EUR 308

DIABLO Rabbit pAb

A13432-200ul 200 ul
EUR 459

DIABLO Rabbit pAb

A13432-20ul 20 ul
EUR 183

DIABLO Rabbit pAb

A13432-50ul 50 ul
EUR 223

DIABLO Blocking Peptide

33R-5520 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DIABLO antibody, catalog no. 20R-1288

Smac/DIABLO Antibody

EUR 316

Smac/DIABLO Antibody

EUR 146

Smac/DIABLO Antibody

39330-100ul 100ul
EUR 390

DIABLO Blocking Peptide

DF7017-BP 1mg
EUR 195

Smac / DIABLO Antibody

abx037649-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Human DIABLO Protein

abx060001-100ug 100 ug
EUR 328
  • Shipped within 5-10 working days.

SMAC / DIABLO Antibody

  • EUR 704.00
  • EUR 328.00
  • EUR 230.00
  • 100 ug
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.


  • EUR 4490.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

DIABLO Conjugated Antibody

C48991 100ul
EUR 397

DIABLO Conjugated Antibody

C32716 100ul
EUR 397

DIABLO Conjugated Antibody

C31125 100ul
EUR 397

DIABLO cloning plasmid

CSB-CL865113HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 720
  • Sequence: atggcggctctgaagagttggctgtcgcgcagcgtaacttcattcttcaggtacagacagtgtttgtgtgttcctgttgtggctaactttaagaagcggtgtttctcagaattgataagaccatggcacaaaactgtgacgattggctttggagtaaccctgtgtgcggttcctat
  • Show more
Description: A cloning plasmid for the DIABLO gene.

DIABLO Rabbit pAb

A2564-100ul 100 ul
EUR 308

DIABLO Rabbit pAb

A2564-200ul 200 ul
EUR 459

DIABLO Rabbit pAb

A2564-20ul 20 ul
EUR 183

DIABLO Rabbit pAb

A2564-50ul 50 ul
EUR 223

anti- DIABLO antibody

FNab02384 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • IP: 1:500-1:1000
  • IHC: 1:20-1:200
  • Immunogen: diablo homolog(Drosophila)
  • Uniprot ID: Q9NR28
  • Gene ID: 56616
  • Research Area: Cancer
Description: Antibody raised against DIABLO


LF-PA0045 100 ul
EUR 334
Description: Rabbit polyclonal to Smac/Diablo

Anti-DIABLO antibody

PAab02384 100 ug
EUR 355

anti-Smac / Diablo

YF-PA20009 50 ul
EUR 363
Description: Mouse polyclonal to Smac / Diablo

anti-Smac / Diablo

YF-PA20010 100 ug
EUR 403
Description: Rabbit polyclonal to Smac / Diablo

Anti-DIABLO antibody

STJ111037 100 µl
EUR 277
Description: This gene encodes an inhibitor of apoptosis protein (IAP)-binding protein. The encoded mitochondrial protein enters the cytosol when cells undergo apoptosis, and allows activation of caspases by binding to inhibitor of apoptosis proteins. Overexpression of the encoded protein sensitizes tumor cells to apoptosis. A mutation in this gene is associated with young-adult onset of nonsyndromic deafness-64. Alternative splicing results in multiple transcript variants encoding different isoforms.

Anti-DIABLO antibody

STJ115393 100 µl
EUR 277
Description: This gene encodes an inhibitor of apoptosis protein (IAP)-binding protein. The encoded mitochondrial protein enters the cytosol when cells undergo apoptosis, and allows activation of caspases by binding to inhibitor of apoptosis proteins. Overexpression of the encoded protein sensitizes tumor cells to apoptosis. A mutation in this gene is associated with young-adult onset of nonsyndromic deafness-64. Alternative splicing results in multiple transcript variants encoding different isoforms.

Anti-DIABLO antibody

STJ23380 100 µl
EUR 277
Description: This gene encodes an inhibitor of apoptosis protein (IAP)-binding protein. The encoded mitochondrial protein enters the cytosol when cells undergo apoptosis, and allows activation of caspases by binding to inhibitor of apoptosis proteins. Overexpression of the encoded protein sensitizes tumor cells to apoptosis. A mutation in this gene is associated with young-adult onset of nonsyndromic deafness-64. Alternative splicing results in multiple transcript variants encoding different isoforms.

Anserini Smac/DIABLO ELISA Kit

EAS0020 96Tests
EUR 521

Human Diablo/SMAC ELISA Kit

LF-EK50928 1×96T
EUR 648

Rat DIABLO(Diablo Homolog) ELISA Kit