Mouse QPRT(Quinolinate Phosphoribosyltransferase) ELISA Kit

Mouse QPRT(Quinolinate Phosphoribosyltransferase) ELISA Kit

To Order Contact us: [email protected]

Mouse Quinolinate Phosphoribosyltransferase (QPRT) ELISA Kit

SED403Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Quinolinate Phosphoribosyltransferase (QPRT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inte
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Quinolinate Phosphoribosyltransferase (QPRT) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Quinolinate Phosphoribosyltransferase (QPRT) ELISA Kit

SED403Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Quinolinate Phosphoribosyltransferase (QPRT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inte
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Quinolinate Phosphoribosyltransferase (QPRT) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Quinolinate Phosphoribosyltransferase (QPRT) ELISA Kit

SED403Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Quinolinate Phosphoribosyltransferase (QPRT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inte
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Quinolinate Phosphoribosyltransferase (QPRT) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Quinolinate Phosphoribosyltransferase (QPRT) ELISA Kit

  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Quinolinate Phosphoribosyltransferase elisa. Alternative names of the recognized antigen: QPRTase
  • Nicotinate-Nucleotide Pyrophosphorylase(Carboxylating)
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Quinolinate Phosphoribosyltransferase (QPRT) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Quinolinate Phosphoribosyltransferase (QPRT) Antibody

abx028016-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Quinolinate Phosphoribosyltransferase (QPRT) Antibody

abx028016-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Quinolinate Phosphoribosyltransferase (QPRT) Antibody

abx236984-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Mouse Quinolinate Phosphoribosyltransferase (QPRT) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Rat Quinolinate Phosphoribosyltransferase (QPRT) ELISA Kit

abx391879-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Quinolinate Phosphoribosyltransferase (QPRT) ELISA Kit

abx382591-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Quinolinate Phosphoribosyltransferase(QPRT)ELISA Kit

QY-E02422 96T
EUR 361

ELISA kit for Mouse QPRT (Quinolinate Phosphoribosyltransferase)

ELK7445 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Quinolinate Phosphoribosyltransferase (QPRT). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody s
  • Show more
Description: A sandwich ELISA kit for detection of Quinolinate Phosphoribosyltransferase from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Quinolinate Phosphoribosyltransferase-Decarboxylating (QPRT) Antibody

31247-05111 150 ug
EUR 261

QPRT Quinolinate Phosphoribosyltransferase Human Recombinant Protein

PROTQ15274 Regular: 20ug
EUR 317
Description: QPRT Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 317 amino acids (1-297 a.a.) and having a molecular mass of 32.9 kDa. The QPRT is fused to a 20 amino acid His-Tag at N-terminus and purified by proprietary chromatographic techniques.

Human Quinolinate Phosphoribosyltransferase-Decarboxylating (QPRT) Antibody (Biotin Conjugate)

31247-05121 150 ug
EUR 369

Human Quinolinate Phosphoribosyltransferase-Decarboxylating (QPRT) AssayLite Antibody (FITC Conjugate)

31247-05141 150 ug
EUR 428

Human Quinolinate Phosphoribosyltransferase-Decarboxylating (QPRT) AssayLite Antibody (RPE Conjugate)

31247-05151 150 ug
EUR 428

Human Quinolinate Phosphoribosyltransferase-Decarboxylating (QPRT) AssayLite Antibody (APC Conjugate)

31247-05161 150 ug
EUR 428

Human Quinolinate Phosphoribosyltransferase-Decarboxylating (QPRT) AssayLite Antibody (PerCP Conjugate)

31247-05171 150 ug
EUR 471

Quinolinate Phosphoribosyltransferase (Recombinant)

  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Recombinant Human Quinolinate Phosphoribosyltransferase

7-03538 5µg Ask for price

Recombinant Human Quinolinate Phosphoribosyltransferase

7-03539 20µg Ask for price

Recombinant Human Quinolinate Phosphoribosyltransferase

7-03540 1mg Ask for price

Recombinant Human Quinolinate Phosphoribosyltransferase/QPRTase (N-6His)

C257-10ug 10ug
EUR 202
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 150mM NaCl, pH 8.0 .

Recombinant Human Quinolinate Phosphoribosyltransferase/QPRTase (N-6His)

C257-1mg 1mg
EUR 2283
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 150mM NaCl, pH 8.0 .

Recombinant Human Quinolinate Phosphoribosyltransferase/QPRTase (N-6His)

C257-500ug 500ug
EUR 1613
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 150mM NaCl, pH 8.0 .

Recombinant Human Quinolinate Phosphoribosyltransferase/QPRTase (N-6His)

C257-50ug 50ug
EUR 496
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 150mM NaCl, pH 8.0 .

Qprt ELISA Kit (Mouse) (OKCD01759)

OKCD01759 96 Wells
EUR 857
Description: Description of target: Involved in the catabolism of quinolinic acid (QA).;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.124 ng/mL


EF002205 96 Tests
EUR 689

Qprt ELISA Kit| Mouse Nicotinate-nucleotide pyrophosphorylase [

EF016018 96 Tests
EUR 689

Human QPRT AssayMax ELISA Kit

EQ2210-1 96 Well Plate
EUR 477

Mouse Nicotinamide phosphoribosyltransferase(NAMPT) ELISA kit

E03N0539-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Nicotinamide phosphoribosyltransferase(NAMPT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Nicotinamide phosphoribosyltransferase(NAMPT) ELISA kit

E03N0539-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Nicotinamide phosphoribosyltransferase(NAMPT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Nicotinamide phosphoribosyltransferase(NAMPT) ELISA kit

E03N0539-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Nicotinamide phosphoribosyltransferase(NAMPT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse orotate phosphoribosyltransferase (OPRT) ELISA kit

E03O0750-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse orotate phosphoribosyltransferase (OPRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse orotate phosphoribosyltransferase (OPRT) ELISA kit

E03O0750-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse orotate phosphoribosyltransferase (OPRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse orotate phosphoribosyltransferase (OPRT) ELISA kit

E03O0750-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse orotate phosphoribosyltransferase (OPRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Adenine phosphoribosyltransferase(APRT) ELISA kit

E03A1610-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Adenine phosphoribosyltransferase(APRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Adenine phosphoribosyltransferase(APRT) ELISA kit

E03A1610-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Adenine phosphoribosyltransferase(APRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Adenine phosphoribosyltransferase(APRT) ELISA kit

E03A1610-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Adenine phosphoribosyltransferase(APRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Nampt/ Nicotinamide phosphoribosyltransferase ELISA Kit

E1008Mo 1 Kit
EUR 571

Mouse Nicotinamide phosphoribosyltransferase, Nampt ELISA KIT

ELI-02264m 96 Tests
EUR 865

Mouse Adenine Phosphoribosyltransferase (APRT) ELISA Kit

abx388512-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Adenine phosphoribosyltransferase, Aprt ELISA KIT

ELI-49220m 96 Tests
EUR 865

Mouse QPRT shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

QPRT Recombinant Protein (Mouse)

RP166091 100 ug Ask for price

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

Mouse Nicotinate-nucleotide pyrophosphorylase [carboxylating] (Qprt) ELISA Kit

abx259294-96tests 96 tests
EUR 746
  • Shipped within 5-12 working days.

Mouse Qprt(Nicotinate-nucleotide pyrophosphorylase [carboxylating]) ELISA Kit

EM1714 96T
EUR 567.6
  • Detection range: 78.125-5000 pg/ml
  • Alias: Qprt/quinolinate phosphoribosyltransferase,HEL-S-90n/ QPRTase/ nicotinate-nucleotide pyrophosphorylase [carboxylating]/ epididymis secretory sperm binding protein Li 90n/ nicotinate-nucleotide pyrophosphoryla
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 46.875pg/ml

ELISA kit for Mouse Nicotinate-nucleotide pyrophosphorylase (QPRT)

KTE70584-48T 48T
EUR 332
  • Quinolinate is an intermediate in the de novo synthesis pathway of NAD from tryptophan and acts as a potent endogenous excitotoxin through hyperstimulation of N-methyl D-aspartate (NMDA) receptor in the neuron. Elevation of quinolinate levels in the
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Nicotinate-nucleotide pyrophosphorylase (QPRT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Nicotinate-nucleotide pyrophosphorylase (QPRT)

KTE70584-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Quinolinate is an intermediate in the de novo synthesis pathway of NAD from tryptophan and acts as a potent endogenous excitotoxin through hyperstimulation of N-methyl D-aspartate (NMDA) receptor in the neuron. Elevation of quinolinate levels in the
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Nicotinate-nucleotide pyrophosphorylase (QPRT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Nicotinate-nucleotide pyrophosphorylase (QPRT)

KTE70584-96T 96T
EUR 539
  • Quinolinate is an intermediate in the de novo synthesis pathway of NAD from tryptophan and acts as a potent endogenous excitotoxin through hyperstimulation of N-methyl D-aspartate (NMDA) receptor in the neuron. Elevation of quinolinate levels in the
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Nicotinate-nucleotide pyrophosphorylase (QPRT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

QPRT antibody

10R-5552 100 ul
EUR 691
Description: Mouse monoclonal QPRT antibody

QPRT antibody

10R-5553 100 ul
EUR 691
Description: Mouse monoclonal QPRT antibody

QPRT antibody

10R-5554 100 ul
EUR 691
Description: Mouse monoclonal QPRT antibody

QPRT antibody

10R-5556 100 ul
EUR 691
Description: Mouse monoclonal QPRT antibody

QPRT antibody

10R-5557 100 ul
EUR 726
Description: Mouse monoclonal QPRT antibody

QPRT antibody

10R-5559 100 ul
EUR 691
Description: Mouse monoclonal QPRT antibody

QPRT Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against QPRT. Recognizes QPRT from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:200-1:500, IF:1:50-1:200


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA17904 50 ul
EUR 363
Description: Mouse polyclonal to QPRT


YF-PA17905 50 ug
EUR 363
Description: Mouse polyclonal to QPRT


YF-PA17906 50 ul
EUR 363
Description: Mouse polyclonal to QPRT


YF-PA17907 100 ug
EUR 403
Description: Rabbit polyclonal to QPRT


YF-PA17908 100 ug
EUR 403
Description: Rabbit polyclonal to QPRT


YF-PA25898 50 ul
EUR 334
Description: Mouse polyclonal to QPRT

Mouse Hypoxanthine Phosphoribosyltransferase 1 (HPRT1) ELISA Kit

DLR-HPRT1-Mu-48T 48T
EUR 489
  • Should the Mouse Hypoxanthine Phosphoribosyltransferase 1 (HPRT1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Hypoxanthine Phosphoribosyltransferase 1 (HPRT1) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Hypoxanthine Phosphoribosyltransferase 1 (HPRT1) ELISA Kit

DLR-HPRT1-Mu-96T 96T
EUR 635
  • Should the Mouse Hypoxanthine Phosphoribosyltransferase 1 (HPRT1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Hypoxanthine Phosphoribosyltransferase 1 (HPRT1) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Hypoxanthine guanine phosphoribosyltransferase(HPRT1) ELISA kit

E03H1375-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Hypoxanthine guanine phosphoribosyltransferase(HPRT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Hypoxanthine guanine phosphoribosyltransferase(HPRT1) ELISA kit

E03H1375-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Hypoxanthine guanine phosphoribosyltransferase(HPRT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Hypoxanthine guanine phosphoribosyltransferase(HPRT1) ELISA kit

E03H1375-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Hypoxanthine guanine phosphoribosyltransferase(HPRT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Hprt1/ Hypoxanthine-guanine phosphoribosyltransferase ELISA Kit

E0692Mo 1 Kit
EUR 632

Mouse Uracil phosphoribosyltransferase homolog(UPRT) ELISA kit

E03U0053-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Uracil phosphoribosyltransferase homolog(UPRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Uracil phosphoribosyltransferase homolog(UPRT) ELISA kit

E03U0053-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Uracil phosphoribosyltransferase homolog(UPRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Uracil phosphoribosyltransferase homolog(UPRT) ELISA kit

E03U0053-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Uracil phosphoribosyltransferase homolog(UPRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Hypoxanthine Phosphoribosyltransferase 1 (HPRT1) ELISA Kit

  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Uracil phosphoribosyltransferase homolog, Uprt ELISA KIT

ELI-44713m 96 Tests
EUR 865

Mouse Hypoxanthine Phosphoribosyltransferase 1 (HPRT1) ELISA Kit

abx570666-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

ELISA kit for Mouse Nicotinamide phosphoribosyltransferase (NAMPT)

KTE70831-48T 48T
EUR 354
  • Nicotinamide phosphoribosyltransferase (NAmPRTase or Nampt) also known as pre-B-cell colony-enhancing factor 1 (PBEF1) or visfatin is an enzyme that in humans is encoded by the PBEF1 gene. This protein is the rate-limiting enzyme in the nNicotinamide
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Nicotinamide phosphoribosyltransferase (NAMPT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Nicotinamide phosphoribosyltransferase (NAMPT)

KTE70831-5platesof96wells 5 plates of 96 wells
EUR 2252
  • Nicotinamide phosphoribosyltransferase (NAmPRTase or Nampt) also known as pre-B-cell colony-enhancing factor 1 (PBEF1) or visfatin is an enzyme that in humans is encoded by the PBEF1 gene. This protein is the rate-limiting enzyme in the nNicotinamide
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Nicotinamide phosphoribosyltransferase (NAMPT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Nicotinamide phosphoribosyltransferase (NAMPT)

KTE70831-96T 96T
EUR 572
  • Nicotinamide phosphoribosyltransferase (NAmPRTase or Nampt) also known as pre-B-cell colony-enhancing factor 1 (PBEF1) or visfatin is an enzyme that in humans is encoded by the PBEF1 gene. This protein is the rate-limiting enzyme in the nNicotinamide
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Nicotinamide phosphoribosyltransferase (NAMPT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Mouse Hypoxanthine Phosphoribosyltransferase 1 (HPRT1) ELISA Kit

SEA717Mu-10x96wellstestplate 10x96-wells test plate
EUR 4391.16
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Hypoxanthine Phosphoribosyltransferase 1 (HPRT1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Hypoxanthine Phosphoribosyltransferase 1 (HPRT1) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Hypoxanthine Phosphoribosyltransferase 1 (HPRT1) ELISA Kit

SEA717Mu-1x48wellstestplate 1x48-wells test plate
EUR 449.27
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Hypoxanthine Phosphoribosyltransferase 1 (HPRT1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Hypoxanthine Phosphoribosyltransferase 1 (HPRT1) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Hypoxanthine Phosphoribosyltransferase 1 (HPRT1) ELISA Kit

SEA717Mu-1x96wellstestplate 1x96-wells test plate
EUR 598.96
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Hypoxanthine Phosphoribosyltransferase 1 (HPRT1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Hypoxanthine Phosphoribosyltransferase 1 (HPRT1) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Hypoxanthine Phosphoribosyltransferase 1 (HPRT1) ELISA Kit

SEA717Mu-5x96wellstestplate 5x96-wells test plate
EUR 2395.32
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Hypoxanthine Phosphoribosyltransferase 1 (HPRT1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Hypoxanthine Phosphoribosyltransferase 1 (HPRT1) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Hypoxanthine Phosphoribosyltransferase 1 (HPRT1) ELISA Kit

  • EUR 4442.00
  • EUR 2346.00
  • EUR 599.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Hypoxanthine Phosphoribosyltransferase 1 elisa. Alternative names of the recognized antigen: HGPRT
  • HGPRTase
  • HPRT
  • Lesch-Nyhan Syndrome
  • Hypoxanthine-guanine phosphoribosyltransferase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Hypoxanthine Phosphoribosyltransferase 1 (HPRT1) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Hypoxanthine Phosphoribosyltransferase 1 (HPRT1) ELISA Kit

RDR-HPRT1-Mu-48Tests 48 Tests
EUR 511

Mouse Hypoxanthine Phosphoribosyltransferase 1 (HPRT1) ELISA Kit

RDR-HPRT1-Mu-96Tests 96 Tests
EUR 709

Mouse Hypoxanthine Phosphoribosyltransferase 1 (HPRT1) ELISA Kit

RD-HPRT1-Mu-48Tests 48 Tests
EUR 489

Mouse Hypoxanthine Phosphoribosyltransferase 1 (HPRT1) ELISA Kit

RD-HPRT1-Mu-96Tests 96 Tests
EUR 677

Aprt ELISA Kit| Mouse Adenine phosphoribosyltransferase ELISA K

EF014137 96 Tests
EUR 689

Qprt ORF Vector (Mouse) (pORF)

ORF055365 1.0 ug DNA
EUR 506

ELISA kit for Mouse HPRT1 (Hypoxanthine Phosphoribosyltransferase 1)

ELK3104 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Hypoxanthine Phosphoribosyltransferase 1 (HPRT1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibo
  • Show more
Description: A sandwich ELISA kit for detection of Hypoxanthine Phosphoribosyltransferase 1 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

QPRT ELISA Kit| Bovine Nicotinate-nucleotide pyrophosphorylase

EF011830 96 Tests
EUR 689

QPRT Polyclonal Antibody

28521-100ul 100ul
EUR 252

QPRT Polyclonal Antibody

28521-50ul 50ul
EUR 187

QPRT Rabbit pAb

A14349-100ul 100 ul
EUR 308

QPRT Rabbit pAb

A14349-200ul 200 ul
EUR 459

QPRT Rabbit pAb

A14349-20ul 20 ul
EUR 183

QPRT Rabbit pAb

A14349-50ul 50 ul
EUR 223

QPRT cloning plasmid

CSB-CL621868HU1-10ug 10ug
EUR 360
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 894
  • Sequence: atggacgctgaaggcctggcgctgctgctgccgcccgtcaccctggcagccctggtggacagctggctccgagaggactgcccagggctcaactacgcagccttggtcagcggggcaggcccctcgcaggcggcgctgtgggccaaatcccctgggatactggcagggcagccttt
  • Show more
Description: A cloning plasmid for the QPRT gene.

QPRT cloning plasmid

CSB-CL621868HU2-10ug 10ug
EUR 360
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 894
  • Sequence: atggacgctgaaggcctggcgctgctgctgccgcccgtcaccctggcagccctggtggacagctggctccgagaggactgcccagggctcaactacgcagccttggtcagcggggcaggcccctcgcaggcggcgctgtgggccaaatcccctggggtactggcagggcagccttt
  • Show more
Description: A cloning plasmid for the QPRT gene.

anti- QPRT antibody

FNab06984 100µg
EUR 585
  • Immunogen: quinolinate phosphoribosyltransferase
  • Uniprot ID: Q15274
  • Gene ID: 23475
  • Research Area: Metabolism
Description: Antibody raised against QPRT

anti-QPRT (5D11)

LF-MA10263 100 ug
EUR 363
Description: Mouse monoclonal to QPRT

Anti-QPRT antibody

PAab06984 100 ug
EUR 412

Anti-QPRT antibody

STJ116561 100 µl
EUR 277
Description: This gene encodes a key enzyme in catabolism of quinolinate, an intermediate in the tryptophan-nicotinamide adenine dinucleotide pathway. Quinolinate acts as a most potent endogenous exitotoxin to neurons. Elevation of quinolinate levels in the brain has been linked to the pathogenesis of neurodegenerative disorders such as epilepsy, Alzheimer's disease, and Huntington's disease. Alternative splicing results in multiple transcript variants.

Human Adenine Phosphoribosyltransferase (APRT) ELISA Kit

EUR 517
  • Should the Human Adenine Phosphoribosyltransferase (APRT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Adenine Phosphoribosyltransferase (APRT) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Adenine Phosphoribosyltransferase (APRT) ELISA Kit

EUR 673
  • Should the Human Adenine Phosphoribosyltransferase (APRT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Adenine Phosphoribosyltransferase (APRT) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Uracil Phosphoribosyltransferase (UPRT) ELISA Kit

EUR 554
  • Should the Human Uracil Phosphoribosyltransferase (UPRT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Uracil Phosphoribosyltransferase (UPRT) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Uracil Phosphoribosyltransferase (UPRT) ELISA Kit

EUR 725
  • Should the Human Uracil Phosphoribosyltransferase (UPRT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Uracil Phosphoribosyltransferase (UPRT) in samples from tissue homogenates, cell lysates or other biological fluids.

Pig NAMPT/ Nicotinamide phosphoribosyltransferase ELISA Kit

E0138Pi 1 Kit
EUR 717

Rat Nicotinamide phosphoribosyltransferase(NAMPT) ELISA kit

E02N0539-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Nicotinamide phosphoribosyltransferase(NAMPT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Nicotinamide phosphoribosyltransferase(NAMPT) ELISA kit

E02N0539-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Nicotinamide phosphoribosyltransferase(NAMPT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Nicotinamide phosphoribosyltransferase(NAMPT) ELISA kit

E02N0539-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Nicotinamide phosphoribosyltransferase(NAMPT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat orotate phosphoribosyltransferase (OPRT) ELISA kit

E02O0750-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat orotate phosphoribosyltransferase (OPRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat orotate phosphoribosyltransferase (OPRT) ELISA kit

E02O0750-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat orotate phosphoribosyltransferase (OPRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat orotate phosphoribosyltransferase (OPRT) ELISA kit

E02O0750-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat orotate phosphoribosyltransferase (OPRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Adenine phosphoribosyltransferase(APRT) ELISA kit

E01A1610-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Adenine phosphoribosyltransferase(APRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Adenine phosphoribosyltransferase(APRT) ELISA kit

E01A1610-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Adenine phosphoribosyltransferase(APRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Adenine phosphoribosyltransferase(APRT) ELISA kit

E01A1610-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Adenine phosphoribosyltransferase(APRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Nicotinamide phosphoribosyltransferase(NAMPT) ELISA kit

E01N0539-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Nicotinamide phosphoribosyltransferase(NAMPT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Nicotinamide phosphoribosyltransferase(NAMPT) ELISA kit

E01N0539-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Nicotinamide phosphoribosyltransferase(NAMPT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Nicotinamide phosphoribosyltransferase(NAMPT) ELISA kit

E01N0539-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Nicotinamide phosphoribosyltransferase(NAMPT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit orotate phosphoribosyltransferase (OPRT) ELISA kit

E04O0750-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit orotate phosphoribosyltransferase (OPRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit orotate phosphoribosyltransferase (OPRT) ELISA kit

E04O0750-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit orotate phosphoribosyltransferase (OPRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit orotate phosphoribosyltransferase (OPRT) ELISA kit

E04O0750-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit orotate phosphoribosyltransferase (OPRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Nicotinamide phosphoribosyltransferase(NAMPT) ELISA kit

E04N0539-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Nicotinamide phosphoribosyltransferase(NAMPT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Nicotinamide phosphoribosyltransferase(NAMPT) ELISA kit

E04N0539-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Nicotinamide phosphoribosyltransferase(NAMPT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Nicotinamide phosphoribosyltransferase(NAMPT) ELISA kit

E04N0539-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Nicotinamide phosphoribosyltransferase(NAMPT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Adenine phosphoribosyltransferase(APRT) ELISA kit

E02A1610-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Adenine phosphoribosyltransferase(APRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Adenine phosphoribosyltransferase(APRT) ELISA kit

E02A1610-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Adenine phosphoribosyltransferase(APRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Adenine phosphoribosyltransferase(APRT) ELISA kit

E02A1610-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Adenine phosphoribosyltransferase(APRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Adenine phosphoribosyltransferase(APRT) ELISA kit

E06A1610-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Adenine phosphoribosyltransferase(APRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Adenine phosphoribosyltransferase(APRT) ELISA kit

E06A1610-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Adenine phosphoribosyltransferase(APRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Adenine phosphoribosyltransferase(APRT) ELISA kit

E06A1610-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Adenine phosphoribosyltransferase(APRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Nampt/ Nicotinamide phosphoribosyltransferase ELISA Kit

E0659Ra 1 Kit
EUR 571

Rabbit Adenine phosphoribosyltransferase(APRT) ELISA kit

E04A1610-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Adenine phosphoribosyltransferase(APRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Adenine phosphoribosyltransferase(APRT) ELISA kit

E04A1610-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Adenine phosphoribosyltransferase(APRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Adenine phosphoribosyltransferase(APRT) ELISA kit

E04A1610-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Adenine phosphoribosyltransferase(APRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human orotate phosphoribosyltransferase (OPRT) ELISA kit

E01O0750-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human orotate phosphoribosyltransferase (OPRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human orotate phosphoribosyltransferase (OPRT) ELISA kit

E01O0750-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human orotate phosphoribosyltransferase (OPRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human orotate phosphoribosyltransferase (OPRT) ELISA kit

E01O0750-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human orotate phosphoribosyltransferase (OPRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Adenine phosphoribosyltransferase(APRT) ELISA kit

E07A1610-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Adenine phosphoribosyltransferase(APRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Adenine phosphoribosyltransferase(APRT) ELISA kit

E07A1610-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Adenine phosphoribosyltransferase(APRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Adenine phosphoribosyltransferase(APRT) ELISA kit

E07A1610-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Adenine phosphoribosyltransferase(APRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Adenine Phosphoribosyltransferase (APRT) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Uracil Phosphoribosyltransferase (UPRT) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Dog orotate phosphoribosyltransferase (OPRT) ELISA kit

E08O0750-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine orotate phosphoribosyltransferase (OPRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog orotate phosphoribosyltransferase (OPRT) ELISA kit

E08O0750-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine orotate phosphoribosyltransferase (OPRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog orotate phosphoribosyltransferase (OPRT) ELISA kit

E08O0750-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine orotate phosphoribosyltransferase (OPRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Adenine phosphoribosyltransferase(APRT) ELISA kit

E08A1610-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Adenine phosphoribosyltransferase(APRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Adenine phosphoribosyltransferase(APRT) ELISA kit

E08A1610-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Adenine phosphoribosyltransferase(APRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Adenine phosphoribosyltransferase(APRT) ELISA kit

E08A1610-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Adenine phosphoribosyltransferase(APRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Nicotinamide phosphoribosyltransferase(NAMPT) ELISA kit

E06N0539-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Nicotinamide phosphoribosyltransferase(NAMPT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Nicotinamide phosphoribosyltransferase(NAMPT) ELISA kit

E06N0539-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Nicotinamide phosphoribosyltransferase(NAMPT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Nicotinamide phosphoribosyltransferase(NAMPT) ELISA kit

E06N0539-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Nicotinamide phosphoribosyltransferase(NAMPT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Nicotinamide phosphoribosyltransferase(NAMPT) ELISA kit

E08N0539-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Nicotinamide phosphoribosyltransferase(NAMPT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Nicotinamide phosphoribosyltransferase(NAMPT) ELISA kit

E08N0539-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Nicotinamide phosphoribosyltransferase(NAMPT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Nicotinamide phosphoribosyltransferase(NAMPT) ELISA kit

E08N0539-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Nicotinamide phosphoribosyltransferase(NAMPT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Nicotinamide phosphoribosyltransferase(NAMPT) ELISA kit

E07N0539-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Nicotinamide phosphoribosyltransferase(NAMPT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Nicotinamide phosphoribosyltransferase(NAMPT) ELISA kit

E07N0539-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Nicotinamide phosphoribosyltransferase(NAMPT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Nicotinamide phosphoribosyltransferase(NAMPT) ELISA kit

E07N0539-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Nicotinamide phosphoribosyltransferase(NAMPT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat orotate phosphoribosyltransferase (OPRT) ELISA kit

E06O0750-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat orotate phosphoribosyltransferase (OPRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat orotate phosphoribosyltransferase (OPRT) ELISA kit

E06O0750-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat orotate phosphoribosyltransferase (OPRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat orotate phosphoribosyltransferase (OPRT) ELISA kit

E06O0750-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat orotate phosphoribosyltransferase (OPRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig orotate phosphoribosyltransferase (OPRT) ELISA kit

E07O0750-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine orotate phosphoribosyltransferase (OPRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig orotate phosphoribosyltransferase (OPRT) ELISA kit

E07O0750-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine orotate phosphoribosyltransferase (OPRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig orotate phosphoribosyltransferase (OPRT) ELISA kit

E07O0750-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine orotate phosphoribosyltransferase (OPRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Adenine phosphoribosyltransferase(APRT) ELISA kit

E09A1610-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Adenine phosphoribosyltransferase(APRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Adenine phosphoribosyltransferase(APRT) ELISA kit

E09A1610-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Adenine phosphoribosyltransferase(APRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Adenine phosphoribosyltransferase(APRT) ELISA kit

E09A1610-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Adenine phosphoribosyltransferase(APRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Nicotinamide phosphoribosyltransferase(NAMPT) ELISA kit

E09N0539-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Nicotinamide phosphoribosyltransferase(NAMPT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Nicotinamide phosphoribosyltransferase(NAMPT) ELISA kit

E09N0539-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Nicotinamide phosphoribosyltransferase(NAMPT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Nicotinamide phosphoribosyltransferase(NAMPT) ELISA kit

E09N0539-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Nicotinamide phosphoribosyltransferase(NAMPT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human NAMPT/ Nicotinamide phosphoribosyltransferase ELISA Kit

E2812Hu 1 Kit
EUR 563

Monkey orotate phosphoribosyltransferase (OPRT) ELISA kit

E09O0750-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey orotate phosphoribosyltransferase (OPRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey orotate phosphoribosyltransferase (OPRT) ELISA kit

E09O0750-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey orotate phosphoribosyltransferase (OPRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey orotate phosphoribosyltransferase (OPRT) ELISA kit

E09O0750-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey orotate phosphoribosyltransferase (OPRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human NAMPT(Nicotinamide phosphoribosyltransferase) ELISA Kit

EH0651 96T
EUR 524.1
  • Detection range: 0.313-20 ng/ml
  • Uniprot ID: P43490
  • Alias: VF(Visfatin)/NAMPT/NAmPRTase/NMPRTase/PBEF1/Visfatin/NAmPRTase/Nampt/nicotinamide phosphoribosyltransferase/Pre-B cell-enhancing factor/pre-B-cell colony enhancing factor 1/Pre-B-cell colony-e
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Bovine Adenine phosphoribosyltransferase, APRT ELISA KIT

ELI-24357b 96 Tests
EUR 928

Human Adenine phosphoribosyltransferase, APRT ELISA KIT

ELI-24358h 96 Tests
EUR 824

Human Nicotinamide phosphoribosyltransferase, NAMPT ELISA KIT

ELI-02262h 96 Tests
EUR 824

Porcine Nicotinamide phosphoribosyltransferase, NAMPT ELISA KIT

ELI-02263p 96 Tests
EUR 928

Human Nicotinate Phosphoribosyltransferase (NAPRT1) ELISA Kit

abx381683-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat Adenine Phosphoribosyltransferase (APRT) ELISA Kit

abx390931-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Uracil Phosphoribosyltransferase (UPRT) ELISA Kit

RDR-UPRT-Hu-48Tests 48 Tests
EUR 589

Human Uracil Phosphoribosyltransferase (UPRT) ELISA Kit

RDR-UPRT-Hu-96Tests 96 Tests
EUR 820

Human Adenine Phosphoribosyltransferase (APRT) ELISA Kit

RDR-APRT-Hu-48Tests 48 Tests
EUR 544

Human Adenine Phosphoribosyltransferase (APRT) ELISA Kit

RDR-APRT-Hu-96Tests 96 Tests
EUR 756

Human Uracil Phosphoribosyltransferase (UPRT) ELISA Kit

RD-UPRT-Hu-48Tests 48 Tests
EUR 563

Human Uracil Phosphoribosyltransferase (UPRT) ELISA Kit

RD-UPRT-Hu-96Tests 96 Tests
EUR 783

Human Adenine Phosphoribosyltransferase (APRT) ELISA Kit

SEC310Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Adenine Phosphoribosyltransferase (APRT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-As
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Adenine Phosphoribosyltransferase (APRT) in Tissue homogenates, cell lysates and other biological fluids.

Human Adenine Phosphoribosyltransferase (APRT) ELISA Kit

SEC310Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Adenine Phosphoribosyltransferase (APRT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-As
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Adenine Phosphoribosyltransferase (APRT) in Tissue homogenates, cell lysates and other biological fluids.

Human Adenine Phosphoribosyltransferase (APRT) ELISA Kit

SEC310Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Adenine Phosphoribosyltransferase (APRT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-As
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Adenine Phosphoribosyltransferase (APRT) in Tissue homogenates, cell lysates and other biological fluids.

Human Adenine Phosphoribosyltransferase (APRT) ELISA Kit

SEC310Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Adenine Phosphoribosyltransferase (APRT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-As
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Adenine Phosphoribosyltransferase (APRT) in Tissue homogenates, cell lysates and other biological fluids.

Human Adenine Phosphoribosyltransferase (APRT) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Adenine Phosphoribosyltransferase elisa. Alternative names of the recognized antigen: AMP
  • APRTase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Adenine Phosphoribosyltransferase (APRT) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Adenine Phosphoribosyltransferase (APRT) ELISA Kit

RD-APRT-Hu-48Tests 48 Tests
EUR 521

Human Adenine Phosphoribosyltransferase (APRT) ELISA Kit

RD-APRT-Hu-96Tests 96 Tests
EUR 723

Human Uracil Phosphoribosyltransferase (UPRT) ELISA Kit

SEM983Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Uracil Phosphoribosyltransferase (UPRT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Ass
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uracil Phosphoribosyltransferase (UPRT) in Tissue homogenates, cell lysates and other biological fluids.

Human Uracil Phosphoribosyltransferase (UPRT) ELISA Kit

SEM983Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Uracil Phosphoribosyltransferase (UPRT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Ass
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uracil Phosphoribosyltransferase (UPRT) in Tissue homogenates, cell lysates and other biological fluids.

Human Uracil Phosphoribosyltransferase (UPRT) ELISA Kit

SEM983Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Uracil Phosphoribosyltransferase (UPRT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Ass
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uracil Phosphoribosyltransferase (UPRT) in Tissue homogenates, cell lysates and other biological fluids.

Human Uracil Phosphoribosyltransferase (UPRT) ELISA Kit

SEM983Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Uracil Phosphoribosyltransferase (UPRT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Ass
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uracil Phosphoribosyltransferase (UPRT) in Tissue homogenates, cell lysates and other biological fluids.

Human Uracil Phosphoribosyltransferase (UPRT) ELISA Kit

  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Uracil Phosphoribosyltransferase elisa. Alternative names of the recognized antigen: FUR1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Uracil Phosphoribosyltransferase (UPRT) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

APRT ELISA Kit| Bovine Adenine phosphoribosyltransferase ELISA

EF011086 96 Tests
EUR 689

Aprt ELISA Kit| Rat Adenine phosphoribosyltransferase ELISA Kit

EF018284 96 Tests
EUR 689

Qprt sgRNA CRISPR Lentivector set (Mouse)

K3433801 3 x 1.0 ug
EUR 339

Qprt ELISA Kit| Rat Nicotinate-nucleotide pyrophosphorylase [ca

EF019239 96 Tests
EUR 689

ELISA kit for Rat Nicotinate-nucleotide pyrophosphorylase (QPRT)

KTE100365-48T 48T
EUR 332
  • Quinolinate is an intermediate in the de novo synthesis pathway of NAD from tryptophan and acts as a potent endogenous excitotoxin through hyperstimulation of N-methyl D-aspartate (NMDA) receptor in the neuron. Elevation of quinolinate levels in the
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Nicotinate-nucleotide pyrophosphorylase (QPRT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Nicotinate-nucleotide pyrophosphorylase (QPRT)

KTE100365-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Quinolinate is an intermediate in the de novo synthesis pathway of NAD from tryptophan and acts as a potent endogenous excitotoxin through hyperstimulation of N-methyl D-aspartate (NMDA) receptor in the neuron. Elevation of quinolinate levels in the
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Nicotinate-nucleotide pyrophosphorylase (QPRT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Nicotinate-nucleotide pyrophosphorylase (QPRT)

KTE100365-96T 96T
EUR 539
  • Quinolinate is an intermediate in the de novo synthesis pathway of NAD from tryptophan and acts as a potent endogenous excitotoxin through hyperstimulation of N-methyl D-aspartate (NMDA) receptor in the neuron. Elevation of quinolinate levels in the
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Nicotinate-nucleotide pyrophosphorylase (QPRT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Nicotinate-nucleotide pyrophosphorylase (QPRT)

KTE61003-48T 48T
EUR 332
  • Quinolinate is an intermediate in the de novo synthesis pathway of NAD from tryptophan and acts as a potent endogenous excitotoxin through hyperstimulation of N-methyl D-aspartate (NMDA) receptor in the neuron. Elevation of quinolinate levels in the
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Nicotinate-nucleotide pyrophosphorylase (QPRT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Nicotinate-nucleotide pyrophosphorylase (QPRT)

KTE61003-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Quinolinate is an intermediate in the de novo synthesis pathway of NAD from tryptophan and acts as a potent endogenous excitotoxin through hyperstimulation of N-methyl D-aspartate (NMDA) receptor in the neuron. Elevation of quinolinate levels in the
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Nicotinate-nucleotide pyrophosphorylase (QPRT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Nicotinate-nucleotide pyrophosphorylase (QPRT)

KTE61003-96T 96T
EUR 539
  • Quinolinate is an intermediate in the de novo synthesis pathway of NAD from tryptophan and acts as a potent endogenous excitotoxin through hyperstimulation of N-methyl D-aspartate (NMDA) receptor in the neuron. Elevation of quinolinate levels in the
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Nicotinate-nucleotide pyrophosphorylase (QPRT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Nicotinate-nucleotide pyrophosphorylase (QPRT)

KTE10132-48T 48T
EUR 354
  • Quinolinate is an intermediate in the de novo synthesis pathway of NAD from tryptophan and acts as a potent endogenous excitotoxin through hyperstimulation of N-methyl D-aspartate (NMDA) receptor in the neuron. Elevation of quinolinate levels in the
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Nicotinate-nucleotide pyrophosphorylase (QPRT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Nicotinate-nucleotide pyrophosphorylase (QPRT)

KTE10132-5platesof96wells 5 plates of 96 wells
EUR 2252
  • Quinolinate is an intermediate in the de novo synthesis pathway of NAD from tryptophan and acts as a potent endogenous excitotoxin through hyperstimulation of N-methyl D-aspartate (NMDA) receptor in the neuron. Elevation of quinolinate levels in the
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Nicotinate-nucleotide pyrophosphorylase (QPRT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Nicotinate-nucleotide pyrophosphorylase (QPRT)

KTE10132-96T 96T
EUR 572
  • Quinolinate is an intermediate in the de novo synthesis pathway of NAD from tryptophan and acts as a potent endogenous excitotoxin through hyperstimulation of N-methyl D-aspartate (NMDA) receptor in the neuron. Elevation of quinolinate levels in the
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Nicotinate-nucleotide pyrophosphorylase (QPRT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Mouse Hypoxanthine Phosphoribosyltransferase 1 (HPRT1) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Human Hypoxanthine Phosphoribosyltransferase 1 (HPRT1) ELISA Kit

DLR-HPRT1-Hu-48T 48T
EUR 479
  • Should the Human Hypoxanthine Phosphoribosyltransferase 1 (HPRT1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Hypoxanthine Phosphoribosyltransferase 1 (HPRT1) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Human Hypoxanthine Phosphoribosyltransferase 1 (HPRT1) ELISA Kit

DLR-HPRT1-Hu-96T 96T
EUR 621
  • Should the Human Hypoxanthine Phosphoribosyltransferase 1 (HPRT1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Hypoxanthine Phosphoribosyltransferase 1 (HPRT1) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Rat Hypoxanthine guanine phosphoribosyltransferase(HPRT1) ELISA kit

E02H1375-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Hypoxanthine guanine phosphoribosyltransferase(HPRT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Hypoxanthine guanine phosphoribosyltransferase(HPRT1) ELISA kit

E02H1375-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Hypoxanthine guanine phosphoribosyltransferase(HPRT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Hypoxanthine guanine phosphoribosyltransferase(HPRT1) ELISA kit

E02H1375-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Hypoxanthine guanine phosphoribosyltransferase(HPRT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Uracil phosphoribosyltransferase homolog(UPRT) ELISA kit

E02U0053-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Uracil phosphoribosyltransferase homolog(UPRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Uracil phosphoribosyltransferase homolog(UPRT) ELISA kit

E02U0053-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Uracil phosphoribosyltransferase homolog(UPRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Uracil phosphoribosyltransferase homolog(UPRT) ELISA kit

E02U0053-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Uracil phosphoribosyltransferase homolog(UPRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Adenine phosphoribosyltransferase(APRT) ELISA kit

E05A1610-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Adenine phosphoribosyltransferase(APRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Adenine phosphoribosyltransferase(APRT) ELISA kit

E05A1610-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Adenine phosphoribosyltransferase(APRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Adenine phosphoribosyltransferase(APRT) ELISA kit

E05A1610-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Adenine phosphoribosyltransferase(APRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Hypoxanthine guanine phosphoribosyltransferase(HPRT1) ELISA kit

E04H1375-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Hypoxanthine guanine phosphoribosyltransferase(HPRT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Hypoxanthine guanine phosphoribosyltransferase(HPRT1) ELISA kit

E04H1375-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Hypoxanthine guanine phosphoribosyltransferase(HPRT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse QPRT(Quinolinate Phosphoribosyltransferase) ELISA Kit