Rat HEPH(Hephaestin) ELISA Kit

Rat HEPH(Hephaestin) ELISA Kit

To Order Contact us: [email protected]

Rat Hephaestin (HEPH) ELISA Kit
RD-HEPH-Ra-96Tests 96 Tests
EUR 775
Human Hephaestin (HEPH) ELISA Kit
DLR-HEPH-Hu-48T 48T
EUR 517
  • Should the Human Hephaestin (HEPH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Hephaestin (HEPH) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Hephaestin (HEPH) ELISA Kit
DLR-HEPH-Hu-96T 96T
EUR 673
  • Should the Human Hephaestin (HEPH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Hephaestin (HEPH) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Hephaestin (HEPH) ELISA Kit
RDR-HEPH-Hu-48Tests 48 Tests
EUR 544
Human Hephaestin (HEPH) ELISA Kit
RDR-HEPH-Hu-96Tests 96 Tests
EUR 756
Human Hephaestin (HEPH) ELISA Kit
RD-HEPH-Hu-48Tests 48 Tests
EUR 521
Human Hephaestin (HEPH) ELISA Kit
RD-HEPH-Hu-96Tests 96 Tests
EUR 723
Rat Hephaestin (HEPH) ELISA Kit
20-abx258621
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Rat Hephaestin, HEPH ELISA Kit
ELA-E0338r 96 Tests
EUR 886
Rat Hephaestin (HEPH) ELISA Kit
abx576700-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Rat Hephaestin (HEPH) ELISA Kit
QY-E11775 96T
EUR 374
Rat Hephaestin (HEPH) ELISA Kit
SEH918Ra-10x96wellstestplate 10x96-wells test plate
EUR 5124.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Hephaestin (HEPH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Hephaestin (HEPH) in serum, plasma, tissue homogenates and other biological fluids.
Rat Hephaestin (HEPH) ELISA Kit
SEH918Ra-1x48wellstestplate 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Hephaestin (HEPH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Hephaestin (HEPH) in serum, plasma, tissue homogenates and other biological fluids.
Rat Hephaestin (HEPH) ELISA Kit
SEH918Ra-1x96wellstestplate 1x96-wells test plate
EUR 685.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Hephaestin (HEPH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Hephaestin (HEPH) in serum, plasma, tissue homogenates and other biological fluids.
Rat Hephaestin (HEPH) ELISA Kit
SEH918Ra-5x96wellstestplate 5x96-wells test plate
EUR 2783.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Hephaestin (HEPH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Hephaestin (HEPH) in serum, plasma, tissue homogenates and other biological fluids.
Rat Hephaestin (HEPH) ELISA Kit
4-SEH918Ra
  • EUR 5175.00
  • EUR 2734.00
  • EUR 686.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Hephaestin elisa. Alternative names of the recognized antigen: CPL
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Hephaestin (HEPH) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.
ELISA kit for Rat HEPH (Hephaestin)
ELK7588 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Hephaestin (HEPH). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Hephaestin (HEPH
  • Show more
Description: A sandwich ELISA kit for detection of Hephaestin from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Rat Hephaestin (HEPH) CLIA Kit
20-abx495579
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Human Hephaestin (HEPH)ELISA Kit
201-12-2743 96 tests
EUR 440
  • This Hephaestin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Hephaestin (HEPH) ELISA Kit
20-abx151798
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Hephaestin (HEPH) ELISA Kit
abx253815-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.
Human Hephaestin, HEPH ELISA Kit
ELA-E0338h 96 Tests
EUR 824
Mouse Hephaestin, HEPH ELISA Kit
ELA-E0338m 96 Tests
EUR 865
Human HEPH/ Hephaestin ELISA Kit
E1113Hu 1 Kit
EUR 571
Human HEPH(Hephaestin) ELISA Kit
EH0859 96T
EUR 567.6
  • Detection range: 78-5000 pg/ml
  • Uniprot ID: Q9BQS7
  • Alias: HEPH/Hephaestin
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml
Human Hephaestin(HEPH) ELISA kit
CSB-EL010289HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Hephaestin (HEPH) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human Hephaestin(HEPH) ELISA kit
1-CSB-EL010289HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Hephaestin(HEPH) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Human Hephaestin (HEPH) ELISA Kit
abx573980-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.
Mouse Hephaestin (HEPH) ELISA Kit
abx512644-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human Hephaestin(HEPH)ELISA Kit
QY-E04878 96T
EUR 361
Human Hephaestin (HEPH) ELISA Kit
SEH918Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Hephaestin (HEPH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Hephaestin (HEPH) in serum, plasma, tissue homogenates and other biological fluids.
Human Hephaestin (HEPH) ELISA Kit
SEH918Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Hephaestin (HEPH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Hephaestin (HEPH) in serum, plasma, tissue homogenates and other biological fluids.
Human Hephaestin (HEPH) ELISA Kit
SEH918Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Hephaestin (HEPH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Hephaestin (HEPH) in serum, plasma, tissue homogenates and other biological fluids.
Human Hephaestin (HEPH) ELISA Kit
SEH918Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Hephaestin (HEPH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Hephaestin (HEPH) in serum, plasma, tissue homogenates and other biological fluids.
Human Hephaestin (HEPH) ELISA Kit
4-SEH918Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Hephaestin elisa. Alternative names of the recognized antigen: CPL
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Hephaestin (HEPH) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.
Hephaestin (HEPH) Antibody
20-abx116845
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Hephaestin (HEPH) Antibody
abx037992-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Hephaestin (HEPH) Antibody
20-abx129183
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Hephaestin (HEPH) Antibody
20-abx172795
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Hephaestin (HEPH) Antibody
abx233831-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Hephaestin (HEPH) Antibody
20-abx322037
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Recombinant Hephaestin (HEPH)
4-RPH918Hu01
  • EUR 458.40
  • EUR 226.00
  • EUR 1444.00
  • EUR 548.00
  • EUR 996.00
  • EUR 370.00
  • EUR 3460.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9BQS7
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 42.1kDa
  • Isoelectric Point: 5.4
Description: Recombinant Human Hephaestin expressed in: E.coli
ELISA kit for Human HEPH (Hephaestin)
E-EL-H2356 1 plate of 96 wells
EUR 534
  • Gentaur's HEPH ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human HEPH. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human HEPH (Hephaestin) in samples from Serum, Plasma, Cell supernatant
ELISA kit for Human HEPH (Hephaestin)
ELK4180 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Hephaestin (HEPH). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Hephaestin (HEPH
  • Show more
Description: A sandwich ELISA kit for detection of Hephaestin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Human Hephaestin (HEPH) CLIA Kit
20-abx495578
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Human Hephaestin (HEPH) Protein
20-abx166543
  • EUR 648.00
  • EUR 272.00
  • EUR 1943.00
  • EUR 759.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Hephaestin (HEPH) Polyclonal Antibody (Human)
4-PAH918Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HEPH (Ala24~Cys366)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hephaestin (HEPH)
Hephaestin (HEPH) Polyclonal Antibody (Human), APC
4-PAH918Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HEPH (Ala24~Cys366)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hephaestin (HEPH). This antibody is labeled with APC.
Hephaestin (HEPH) Polyclonal Antibody (Human), Biotinylated
4-PAH918Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HEPH (Ala24~Cys366)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hephaestin (HEPH). This antibody is labeled with Biotin.
Hephaestin (HEPH) Polyclonal Antibody (Human), Cy3
4-PAH918Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HEPH (Ala24~Cys366)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hephaestin (HEPH). This antibody is labeled with Cy3.
Hephaestin (HEPH) Polyclonal Antibody (Human), FITC
4-PAH918Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HEPH (Ala24~Cys366)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hephaestin (HEPH). This antibody is labeled with FITC.
Hephaestin (HEPH) Polyclonal Antibody (Human), HRP
4-PAH918Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HEPH (Ala24~Cys366)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hephaestin (HEPH). This antibody is labeled with HRP.
Hephaestin (HEPH) Polyclonal Antibody (Human), PE
4-PAH918Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HEPH (Ala24~Cys366)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hephaestin (HEPH). This antibody is labeled with PE.
Hephaestin (HEPH) Polyclonal Antibody (Human), APC-Cy7
4-PAH918Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HEPH (Ala24~Cys366)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hephaestin (HEPH). This antibody is labeled with APC-Cy7.
HEPH ELISA Kit (Rat) (OKCD02537)
OKCD02537 96 Wells
EUR 896
Description: Description of target: May function as a ferroxidase for ferrous (II) to ferric ion (III) conversion and may be involved in copper transport and homeostasis. Implicated in iron homeostasis and may mediate iron efflux associated to ferroportin 1. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.128 ng/mL
HEPH ELISA KIT|Human
EF000577 96 Tests
EUR 689
Hephaestin Antibody
DF13057 200ul
EUR 304
Description: Hephaestin Antibody detects endogenous levels of Hephaestin.
anti-Hephaestin
YF-PA25419 50 ul
EUR 334
Description: Mouse polyclonal to Hephaestin
HEPH ELISA Kit (Human) (OKCD09126)
OKCD09126 96 Wells
EUR 975
Description: Description of target: May function as a ferroxidase for ferrous (II) to ferric ion (III) conversion and may be involved in copper transport and homeostasis. Implicated in iron homeostasis and may mediate iron efflux associated to ferroportin 1.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.59ng/mL
HEPH ELISA Kit (Mouse) (OKEH05855)
OKEH05855 96 Wells
EUR 662
Description: Description of target: May function as a ferroxidase for ferrous (II) to ferric ion (III) conversion and may be involved in copper transport and homeostasis. Implicated in iron homeostasis and may mediate iron efflux associated to ferroportin 1. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.7 pg/mL
Rat HEPH shRNA Plasmid
20-abx987425
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202
HEPH antibody
70R-17721 50 ul
EUR 435
Description: Rabbit polyclonal HEPH antibody
HEPH antibody
31933-100ul 100ul
EUR 252
HEPH antibody
31933-50ul 50ul
EUR 187
HEPH antibody
70R-7345 50 ug
EUR 467
Description: Rabbit polyclonal HEPH antibody raised against the N terminal of HEPH
HEPH Antibody
1-CSB-PA010289ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against HEPH. Recognizes HEPH from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200
HEPH Antibody
1-CSB-PA010289GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against HEPH. Recognizes HEPH from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC
HEPH siRNA
20-abx902444
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
HEPH siRNA
20-abx919264
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
HEPH siRNA
20-abx919265
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
Hephaestin Blocking Peptide
DF13057-BP 1mg
EUR 195
anti- Hephaestin antibody
FNab03831 100µg
EUR 505.25
  • Immunogen: hephaestin
  • Uniprot ID: Q9BQS7
  • Research Area: Metabolism
Description: Antibody raised against Hephaestin
Anti-Hephaestin antibody
PAab03831 100 ug
EUR 355
Anti-Hephaestin (2D3)
YF-MA17020 100 ug
EUR 363
Description: Mouse monoclonal to Hephaestin
Heph ORF Vector (Rat) (pORF)
ORF068146 1.0 ug DNA
EUR 506
HEPH ELISA Kit (Human) : 96 Wells (OKEH00385)
OKEH00385 96 Wells
EUR 662
Description: Description of target: May function as a ferroxidase for ferrous (II) to ferric ion (III) conversion and may be involved in copper transport and homeostasis. Implicated in iron homeostasis and may mediate iron efflux associated to ferroportin 1.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 31 pg/mL
Mouse Hephaestin- like protein 1, Hephl1 ELISA KIT
ELI-31482m 96 Tests
EUR 865
Human Hephaestin- like protein 1, HEPHL1 ELISA KIT
ELI-07978h 96 Tests
EUR 824
HEPH Blocking Peptide
33R-6088 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HEPH antibody, catalog no. 70R-7345
HEPH cloning plasmid
CSB-CL010289HU-10ug 10ug
EUR 1232
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3477
  • Sequence: atggagtcaggccacctcctctgggctctgctgttcatgcagtccttgtggcctcaactgactgatggagccactcgagtctactacctgggcatccgggatgtgcagtggaactatgctcccaagggaagaaatgtcatcacgaaccagcctctggacagtgacatagtggctt
  • Show more
Description: A cloning plasmid for the HEPH gene.
Custom production of antibodies in 5 Rats using customer supplied antigen (std 63 days protocol)
RAT-5 1
EUR 1138
Heph sgRNA CRISPR Lentivector set (Rat)
K7552401 3 x 1.0 ug
EUR 339
Frit Kit
FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.
Column Packing Kit
PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.
PCR Mycoplasma Detection Kit
M034-Kit Kit
EUR 266
HEPH Polyclonal Conjugated Antibody
C31933 100ul
EUR 397
Human HEPH shRNA Plasmid
20-abx956595
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse HEPH shRNA Plasmid
20-abx970777
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Heph sgRNA CRISPR Lentivector (Rat) (Target 1)
K7552402 1.0 ug DNA
EUR 154
Heph sgRNA CRISPR Lentivector (Rat) (Target 2)
K7552403 1.0 ug DNA
EUR 154
Heph sgRNA CRISPR Lentivector (Rat) (Target 3)
K7552404 1.0 ug DNA
EUR 154
HEPH Protein Vector (Rat) (pPB-C-His)
PV272582 500 ng
EUR 1191
HEPH Protein Vector (Rat) (pPB-N-His)
PV272583 500 ng
EUR 1191
HEPH Protein Vector (Rat) (pPM-C-HA)
PV272584 500 ng
EUR 1191

Rat HEPH(Hephaestin) ELISA Kit