Rat HEPH(Hephaestin) ELISA Kit

Rat HEPH(Hephaestin) ELISA Kit

To Order Contact us: [email protected]

Rat Hephaestin (HEPH) ELISA Kit
RD-HEPH-Ra-96Tests 96 Tests
EUR 775
Human Hephaestin (HEPH) ELISA Kit
DLR-HEPH-Hu-48T 48T
EUR 517
  • Should the Human Hephaestin (HEPH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Hephaestin (HEPH) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Hephaestin (HEPH) ELISA Kit
DLR-HEPH-Hu-96T 96T
EUR 673
  • Should the Human Hephaestin (HEPH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Hephaestin (HEPH) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Hephaestin (HEPH) ELISA Kit
RDR-HEPH-Hu-48Tests 48 Tests
EUR 544
Human Hephaestin (HEPH) ELISA Kit
RDR-HEPH-Hu-96Tests 96 Tests
EUR 756
Human Hephaestin (HEPH) ELISA Kit
RD-HEPH-Hu-48Tests 48 Tests
EUR 521
Human Hephaestin (HEPH) ELISA Kit
RD-HEPH-Hu-96Tests 96 Tests
EUR 723
Rat Hephaestin (HEPH) ELISA Kit
20-abx258621
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Rat Hephaestin, HEPH ELISA Kit
ELA-E0338r 96 Tests
EUR 886
Rat Hephaestin (HEPH) ELISA Kit
abx576700-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Rat Hephaestin (HEPH) ELISA Kit
QY-E11775 96T
EUR 374
Rat Hephaestin (HEPH) ELISA Kit
SEH918Ra-10x96wellstestplate 10x96-wells test plate
EUR 5124.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Hephaestin (HEPH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Hephaestin (HEPH) in serum, plasma, tissue homogenates and other biological fluids.
Rat Hephaestin (HEPH) ELISA Kit
SEH918Ra-1x48wellstestplate 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Hephaestin (HEPH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Hephaestin (HEPH) in serum, plasma, tissue homogenates and other biological fluids.
Rat Hephaestin (HEPH) ELISA Kit
SEH918Ra-1x96wellstestplate 1x96-wells test plate
EUR 685.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Hephaestin (HEPH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Hephaestin (HEPH) in serum, plasma, tissue homogenates and other biological fluids.
Rat Hephaestin (HEPH) ELISA Kit
SEH918Ra-5x96wellstestplate 5x96-wells test plate
EUR 2783.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Hephaestin (HEPH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Hephaestin (HEPH) in serum, plasma, tissue homogenates and other biological fluids.
Rat Hephaestin (HEPH) ELISA Kit
4-SEH918Ra
  • EUR 5175.00
  • EUR 2734.00
  • EUR 686.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Hephaestin elisa. Alternative names of the recognized antigen: CPL
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Hephaestin (HEPH) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.
ELISA kit for Rat HEPH (Hephaestin)
ELK7588 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Hephaestin (HEPH). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Hephaestin (HEPH
  • Show more
Description: A sandwich ELISA kit for detection of Hephaestin from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Rat Hephaestin (HEPH) CLIA Kit
20-abx495579
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Human Hephaestin (HEPH)ELISA Kit
201-12-2743 96 tests
EUR 440
  • This Hephaestin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Hephaestin (HEPH) ELISA Kit
20-abx151798
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Hephaestin (HEPH) ELISA Kit
abx253815-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.
Human Hephaestin, HEPH ELISA Kit
ELA-E0338h 96 Tests
EUR 824
Mouse Hephaestin, HEPH ELISA Kit
ELA-E0338m 96 Tests
EUR 865
Human HEPH/ Hephaestin ELISA Kit
E1113Hu 1 Kit
EUR 571
Human HEPH(Hephaestin) ELISA Kit
EH0859 96T
EUR 567.6
  • Detection range: 78-5000 pg/ml
  • Uniprot ID: Q9BQS7
  • Alias: HEPH/Hephaestin
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml
Human Hephaestin(HEPH) ELISA kit
CSB-EL010289HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Hephaestin (HEPH) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human Hephaestin(HEPH) ELISA kit
1-CSB-EL010289HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Hephaestin(HEPH) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Human Hephaestin (HEPH) ELISA Kit
abx573980-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.
Mouse Hephaestin (HEPH) ELISA Kit
abx512644-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human Hephaestin(HEPH)ELISA Kit
QY-E04878 96T
EUR 361
Human Hephaestin (HEPH) ELISA Kit
SEH918Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Hephaestin (HEPH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Hephaestin (HEPH) in serum, plasma, tissue homogenates and other biological fluids.
Human Hephaestin (HEPH) ELISA Kit
SEH918Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Hephaestin (HEPH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Hephaestin (HEPH) in serum, plasma, tissue homogenates and other biological fluids.
Human Hephaestin (HEPH) ELISA Kit
SEH918Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Hephaestin (HEPH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Hephaestin (HEPH) in serum, plasma, tissue homogenates and other biological fluids.
Human Hephaestin (HEPH) ELISA Kit
SEH918Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Hephaestin (HEPH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Hephaestin (HEPH) in serum, plasma, tissue homogenates and other biological fluids.
Human Hephaestin (HEPH) ELISA Kit
4-SEH918Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Hephaestin elisa. Alternative names of the recognized antigen: CPL
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Hephaestin (HEPH) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.
Hephaestin (HEPH) Antibody
20-abx116845
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Hephaestin (HEPH) Antibody
abx037992-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Hephaestin (HEPH) Antibody
20-abx129183
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Hephaestin (HEPH) Antibody
20-abx172795
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Hephaestin (HEPH) Antibody
abx233831-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Hephaestin (HEPH) Antibody
20-abx322037
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Recombinant Hephaestin (HEPH)
4-RPH918Hu01
  • EUR 458.40
  • EUR 226.00
  • EUR 1444.00
  • EUR 548.00
  • EUR 996.00
  • EUR 370.00
  • EUR 3460.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9BQS7
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 42.1kDa
  • Isoelectric Point: 5.4
Description: Recombinant Human Hephaestin expressed in: E.coli
ELISA kit for Human HEPH (Hephaestin)
E-EL-H2356 1 plate of 96 wells
EUR 534
  • Gentaur's HEPH ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human HEPH. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human HEPH (Hephaestin) in samples from Serum, Plasma, Cell supernatant
ELISA kit for Human HEPH (Hephaestin)
ELK4180 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Hephaestin (HEPH). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Hephaestin (HEPH
  • Show more
Description: A sandwich ELISA kit for detection of Hephaestin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Human Hephaestin (HEPH) CLIA Kit
20-abx495578
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Human Hephaestin (HEPH) Protein
20-abx166543
  • EUR 648.00
  • EUR 272.00
  • EUR 1943.00
  • EUR 759.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Hephaestin (HEPH) Polyclonal Antibody (Human)
4-PAH918Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HEPH (Ala24~Cys366)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hephaestin (HEPH)
Hephaestin (HEPH) Polyclonal Antibody (Human), APC
4-PAH918Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HEPH (Ala24~Cys366)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hephaestin (HEPH). This antibody is labeled with APC.
Hephaestin (HEPH) Polyclonal Antibody (Human), Biotinylated
4-PAH918Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HEPH (Ala24~Cys366)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hephaestin (HEPH). This antibody is labeled with Biotin.
Hephaestin (HEPH) Polyclonal Antibody (Human), Cy3
4-PAH918Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HEPH (Ala24~Cys366)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hephaestin (HEPH). This antibody is labeled with Cy3.
Hephaestin (HEPH) Polyclonal Antibody (Human), FITC
4-PAH918Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HEPH (Ala24~Cys366)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hephaestin (HEPH). This antibody is labeled with FITC.
Hephaestin (HEPH) Polyclonal Antibody (Human), HRP
4-PAH918Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HEPH (Ala24~Cys366)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hephaestin (HEPH). This antibody is labeled with HRP.
Hephaestin (HEPH) Polyclonal Antibody (Human), PE
4-PAH918Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HEPH (Ala24~Cys366)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hephaestin (HEPH). This antibody is labeled with PE.
Hephaestin (HEPH) Polyclonal Antibody (Human), APC-Cy7
4-PAH918Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HEPH (Ala24~Cys366)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hephaestin (HEPH). This antibody is labeled with APC-Cy7.
HEPH ELISA KIT|Human
EF000577 96 Tests
EUR 689
Hephaestin Antibody
DF13057 200ul
EUR 304
Description: Hephaestin Antibody detects endogenous levels of Hephaestin.
anti-Hephaestin
YF-PA25419 50 ul
EUR 334
Description: Mouse polyclonal to Hephaestin
Rat HEPH shRNA Plasmid
20-abx987425
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202
HEPH antibody
70R-17721 50 ul
EUR 435
Description: Rabbit polyclonal HEPH antibody
HEPH antibody
31933-100ul 100ul
EUR 252
HEPH antibody
31933-50ul 50ul
EUR 187
HEPH antibody
70R-7345 50 ug
EUR 467
Description: Rabbit polyclonal HEPH antibody raised against the N terminal of HEPH
HEPH Antibody
1-CSB-PA010289ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against HEPH. Recognizes HEPH from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200
HEPH Antibody
1-CSB-PA010289GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against HEPH. Recognizes HEPH from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC
HEPH siRNA
20-abx902444
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
HEPH siRNA
20-abx919264
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
HEPH siRNA
20-abx919265
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
Hephaestin Blocking Peptide
DF13057-BP 1mg
EUR 195
anti- Hephaestin antibody
FNab03831 100µg
EUR 505.25
  • Immunogen: hephaestin
  • Uniprot ID: Q9BQS7
  • Research Area: Metabolism
Description: Antibody raised against Hephaestin
Anti-Hephaestin antibody
PAab03831 100 ug
EUR 355
Anti-Hephaestin (2D3)
YF-MA17020 100 ug
EUR 363
Description: Mouse monoclonal to Hephaestin
Heph ORF Vector (Rat) (pORF)
ORF068146 1.0 ug DNA
EUR 506
Mouse Hephaestin- like protein 1, Hephl1 ELISA KIT
ELI-31482m 96 Tests
EUR 865
Human Hephaestin- like protein 1, HEPHL1 ELISA KIT
ELI-07978h 96 Tests
EUR 824
HEPH Blocking Peptide
33R-6088 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HEPH antibody, catalog no. 70R-7345
HEPH cloning plasmid
CSB-CL010289HU-10ug 10ug
EUR 1232
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3477
  • Sequence: atggagtcaggccacctcctctgggctctgctgttcatgcagtccttgtggcctcaactgactgatggagccactcgagtctactacctgggcatccgggatgtgcagtggaactatgctcccaagggaagaaatgtcatcacgaaccagcctctggacagtgacatagtggctt
  • Show more
Description: A cloning plasmid for the HEPH gene.
Custom production of antibodies in 5 Rats using customer supplied antigen (std 63 days protocol)
RAT-5 1
EUR 1138
Heph sgRNA CRISPR Lentivector set (Rat)
K7552401 3 x 1.0 ug
EUR 339
Frit Kit
FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.
Column Packing Kit
PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.
PCR Mycoplasma Detection Kit
M034-Kit Kit
EUR 266
HEPH Polyclonal Conjugated Antibody
C31933 100ul
EUR 397
Human HEPH shRNA Plasmid
20-abx956595
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse HEPH shRNA Plasmid
20-abx970777
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Heph sgRNA CRISPR Lentivector (Rat) (Target 1)
K7552402 1.0 ug DNA
EUR 154
Heph sgRNA CRISPR Lentivector (Rat) (Target 2)
K7552403 1.0 ug DNA
EUR 154
Heph sgRNA CRISPR Lentivector (Rat) (Target 3)
K7552404 1.0 ug DNA
EUR 154
HEPH Protein Vector (Rat) (pPB-C-His)
PV272582 500 ng
EUR 1191
HEPH Protein Vector (Rat) (pPB-N-His)
PV272583 500 ng
EUR 1191
HEPH Protein Vector (Rat) (pPM-C-HA)
PV272584 500 ng
EUR 1191
HEPH Protein Vector (Rat) (pPM-C-His)
PV272585 500 ng
EUR 1191
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9
CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9
Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV200PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV205PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV220PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV225PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
HEPH ORF Vector (Human) (pORF)
ORF004854 1.0 ug DNA
EUR 95
Heph ORF Vector (Mouse) (pORF)
ORF047098 1.0 ug DNA
EUR 506
Heph ORF Vector (Mouse) (pORF)
ORF047099 1.0 ug DNA
EUR 506
Heph ORF Vector (Mouse) (pORF)
ORF047100 1.0 ug DNA
EUR 506
Heph ORF Vector (Mouse) (pORF)
ORF047101 1.0 ug DNA
EUR 506
Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9
HEPH Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV674617 1.0 ug DNA
EUR 1355
HEPH Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV674621 1.0 ug DNA
EUR 1355
HEPH Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV674622 1.0 ug DNA
EUR 1355
Mouse Hephaestin (Hp) control/blocking peptide
HEPH11-P 100 ug
EUR 164
Rabbit Anti-Mouse Hephaestin (Hp) antiserum
HEPH11-S 100 ul
EUR 457
Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]
CAS9LIG-KIT 1 Kit
EUR 153
  • Category: Cas9
PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools
PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools
AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE620A-KIT 1 kit
EUR 2132
  • Category: Gene Editing
AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE622A-KIT 1 kit
EUR 2132
  • Category: Gene Editing
AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE624A-KIT 1 kit
EUR 2132
  • Category: Gene Editing
Heph sgRNA CRISPR Lentivector set (Mouse)
K3851001 3 x 1.0 ug
EUR 339
HEPH sgRNA CRISPR Lentivector set (Human)
K0945101 3 x 1.0 ug
EUR 339
vWF Acty. Kit
ABP-ACT-KIT 12 x 8 microwells
EUR 428
vWF Ant. Kit
ABP-TOT-KIT 12 x 8 microwells
EUR 394
Heph sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K7552405 3 x 1.0 ug
EUR 376
hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9)
CAS620A-KIT 1 kit
EUR 2152
  • Category: Cas9
Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression)
PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools
PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools
PrecisionX Multiplex gRNA Cloning Kit
CAS9-GRNA-KIT 10 rxn
EUR 445
  • Category: Cas9
Rabbit Anti-Mouse Hephaestin (Hp) IgG, aff pure
HEPH11-A 100 ug
EUR 482
mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products
Monoclonal HEPH Antibody (monoclonal) (M01), Clone: 2D3
AMM05331G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human HEPH (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2D3. This antibody is applicable in WB, E
Heph sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3851002 1.0 ug DNA
EUR 154
Heph sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3851003 1.0 ug DNA
EUR 154
Heph sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3851004 1.0 ug DNA
EUR 154
HEPH sgRNA CRISPR Lentivector (Human) (Target 1)
K0945102 1.0 ug DNA
EUR 154
HEPH sgRNA CRISPR Lentivector (Human) (Target 2)
K0945103 1.0 ug DNA
EUR 154
HEPH sgRNA CRISPR Lentivector (Human) (Target 3)
K0945104 1.0 ug DNA
EUR 154
HEPH Protein Vector (Mouse) (pPB-C-His)
PV188390 500 ng
EUR 1065
HEPH Protein Vector (Mouse) (pPB-N-His)
PV188391 500 ng
EUR 1065
HEPH Protein Vector (Mouse) (pPM-C-HA)
PV188392 500 ng
EUR 1065
HEPH Protein Vector (Mouse) (pPM-C-His)
PV188393 500 ng
EUR 1065
HEPH Protein Vector (Mouse) (pPB-C-His)
PV188394 500 ng
EUR 1065
HEPH Protein Vector (Mouse) (pPB-N-His)
PV188395 500 ng
EUR 1065
HEPH Protein Vector (Mouse) (pPM-C-HA)
PV188396 500 ng
EUR 1065
HEPH Protein Vector (Mouse) (pPM-C-His)
PV188397 500 ng
EUR 1065
HEPH Protein Vector (Mouse) (pPB-C-His)
PV188398 500 ng
EUR 1065
HEPH Protein Vector (Mouse) (pPB-N-His)
PV188399 500 ng
EUR 1065
HEPH Protein Vector (Mouse) (pPM-C-HA)
PV188400 500 ng
EUR 1065
HEPH Protein Vector (Mouse) (pPM-C-His)
PV188401 500 ng
EUR 1065
HEPH Protein Vector (Mouse) (pPB-C-His)
PV188402 500 ng
EUR 1065
HEPH Protein Vector (Mouse) (pPB-N-His)
PV188403 500 ng
EUR 1065
HEPH Protein Vector (Mouse) (pPM-C-HA)
PV188404 500 ng
EUR 1065
HEPH Protein Vector (Mouse) (pPM-C-His)
PV188405 500 ng
EUR 1065
HEPH Protein Vector (Human) (pPB-C-His)
PV019413 500 ng
EUR 329
HEPH Protein Vector (Human) (pPB-N-His)
PV019414 500 ng
EUR 329
HEPH Protein Vector (Human) (pPM-C-HA)
PV019415 500 ng
EUR 329
HEPH Protein Vector (Human) (pPM-C-His)
PV019416 500 ng
EUR 329
Heph 3'UTR Luciferase Stable Cell Line
TU109455 1.0 ml Ask for price
Heph 3'UTR Luciferase Stable Cell Line
TU205725 1.0 ml Ask for price
Heph 3'UTR GFP Stable Cell Line
TU159455 1.0 ml Ask for price
Heph 3'UTR GFP Stable Cell Line
TU255725 1.0 ml Ask for price
HEPH 3'UTR GFP Stable Cell Line
TU059712 1.0 ml
EUR 1521
HEPH 3'UTR Luciferase Stable Cell Line
TU009712 1.0 ml
EUR 1521
Heph sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K7552406 1.0 ug DNA
EUR 167
Heph sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K7552407 1.0 ug DNA
EUR 167
Heph sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K7552408 1.0 ug DNA
EUR 167
HEPH Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV674618 1.0 ug DNA
EUR 1355
HEPH Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV674619 1.0 ug DNA
EUR 1413
HEPH Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV674620 1.0 ug DNA
EUR 1413
Mouse hephaestin-like protein 1 Zylkopen control/blocking peptide
ZYK11-P 100 ug
EUR 164
Human hephaestin-like protein 1 Zylkopen control/blocking peptide
ZYK12-P 100 ug
EUR 164
ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes
CLOuD9 Gene Expression Regulation Kit (includes 10 ug each of dCas9-PYL1 and dCas9-ABI1 lentivectors, and 100 ul of 0.5M Inducer Agent)
CASCL9-100A-KIT 1 Kit
EUR 1132
  • Category: Cas9
Rabbit Anti-Mouse hephaestin-like protein 1 Zylkopen IgG, aff pure
ZYK11-A 100 ug
EUR 482
Rabbit Anti-Human hephaestin-like protein 1 Zylkopen IgG, aff pure
ZYK12-A 100 ug
EUR 482
Heph sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3851005 3 x 1.0 ug
EUR 376
HEPH sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0945105 3 x 1.0 ug
EUR 376
AXYGEN® AXYPET® PRO STARTER KIT: 4 PIPETTORS, PLEXI STAND, SAMPLE TIPS
AP-STR-KIT-P 1/pk
EUR 721
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller
Heph sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K3851006 1.0 ug DNA
EUR 167
Heph sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K3851007 1.0 ug DNA
EUR 167
Heph sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K3851008 1.0 ug DNA
EUR 167
HEPH sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K0945106 1.0 ug DNA
EUR 167
HEPH sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K0945107 1.0 ug DNA
EUR 167
HEPH sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K0945108 1.0 ug DNA
EUR 167
AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-1 1/pk
EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller
AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-2 1/pk
EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller
/ Rat ELISA Kit
ELA-E0703r 96 Tests
EUR 886
/ Rat ELISA Kit
ELA-E1084r 96 Tests
EUR 886
Hcrt ELISA Kit| Rat Orexin ELISA Kit
EF016909 96 Tests
EUR 689
PI ELISA Kit| Rat Proinsulin ELISA Kit
EF016927 96 Tests
EUR 689
Cck ELISA Kit| Rat Cholecystokinin ELISA Kit
EF016928 96 Tests
EUR 689
ENK ELISA Kit| Rat enkephalin ELISA Kit
EF016935 96 Tests
EUR 689
GRN ELISA Kit| Rat Granulin ELISA Kit
EF016963 96 Tests
EUR 689
PRGN ELISA Kit| Rat progranulin ELISA Kit
EF016964 96 Tests
EUR 689
TPS ELISA Kit| Rat Tryptase ELISA Kit
EF016972 96 Tests
EUR 689
ADM ELISA Kit| Rat Adrenomedullin ELISA Kit
EF016976 96 Tests
EUR 689
Pnoc ELISA Kit| Rat Prepronociceptin ELISA Kit
EF016990 96 Tests
EUR 689
CORT ELISA Kit| Rat Corticosterone ELISA Kit
EF016992 96 Tests
EUR 689
Cort ELISA Kit| Rat Cortistatin ELISA Kit
EF016993 96 Tests
EUR 689
FN ELISA Kit| Rat Fibronectin ELISA Kit
EF017022 96 Tests
EUR 689
LN ELISA Kit| Rat Laminin ELISA Kit
EF017041 96 Tests
EUR 689
Lum ELISA Kit| Rat Lumican ELISA Kit
EF017042 96 Tests
EUR 689
Prl ELISA Kit| Rat Prolactin ELISA Kit
EF017060 96 Tests
EUR 689
Lep ELISA Kit| Rat Leptin ELISA Kit
EF017074 96 Tests
EUR 689
MPO ELISA Kit| Rat Myeloperoxidase ELISA Kit
EF017081 96 Tests
EUR 689
Sost ELISA Kit| Rat Sclerostin ELISA Kit
EF017094 96 Tests
EUR 689
Epo ELISA Kit| Rat Erythropoietin ELISA Kit
EF017100 96 Tests
EUR 689
Fst ELISA Kit| Rat Follistatin ELISA Kit
EF017105 96 Tests
EUR 689
TPO ELISA Kit| Rat Thrombopoietin ELISA Kit
EF017113 96 Tests
EUR 689
Clu ELISA Kit| Rat Clusterin ELISA Kit
EF017114 96 Tests
EUR 689
Cat ELISA Kit| Rat Catalase ELISA Kit
EF017151 96 Tests
EUR 689
Tg ELISA Kit| Rat Thyroglobulin ELISA Kit
EF017170 96 Tests
EUR 689
Nesfatin ELISA Kit| Rat Nesfatin ELISA Kit
EF017172 96 Tests
EUR 689
Nrn1 ELISA Kit| Rat Neuritin ELISA Kit
EF017193 96 Tests
EUR 689
Sst ELISA Kit| Rat Somatostatin ELISA Kit
EF017203 96 Tests
EUR 689
Gck ELISA Kit| Rat Glucokinase ELISA Kit
EF017211 96 Tests
EUR 689
Ttr ELISA Kit| Rat Transthyretin ELISA Kit
EF017224 96 Tests
EUR 689
Agt ELISA Kit| Rat Angiotensinogen ELISA Kit
EF017231 96 Tests
EUR 689
Hp ELISA Kit| Rat Haptoglobin ELISA Kit
EF017233 96 Tests
EUR 689
Trh ELISA Kit| Rat Prothyroliberin ELISA Kit
EF017238 96 Tests
EUR 689
Scgb1a1 ELISA Kit| Rat Uteroglobin ELISA Kit
EF017241 96 Tests
EUR 689
REN ELISA Kit| Rat Renin ELISA Kit
EF017245 96 Tests
EUR 689
Tnmd ELISA Kit| Rat Tenomodulin ELISA Kit
EF017252 96 Tests
EUR 689
Sct ELISA Kit| Rat Secretin ELISA Kit
EF017276 96 Tests
EUR 689
Calb1 ELISA Kit| Rat Calbindin ELISA Kit
EF017283 96 Tests
EUR 689
Rnls ELISA Kit| Rat Renalase ELISA Kit
EF017284 96 Tests
EUR 689
Ache ELISA Kit| Rat Acetylcholinesterase ELISA Kit
EF017303 96 Tests
EUR 689
GT ELISA Kit| Rat Gastrin ELISA Kit
EF017314 96 Tests
EUR 689
Plg ELISA Kit| Rat Plasminogen ELISA Kit
EF017317 96 Tests
EUR 689
Gc ELISA Kit| Rat Glucagon ELISA Kit
EF017328 96 Tests
EUR 689
Ocm ELISA Kit| Rat Oncomodulin ELISA Kit
EF017345 96 Tests
EUR 689
Eln ELISA Kit| Rat Elastin ELISA Kit
EF017346 96 Tests
EUR 689
Mme ELISA Kit| Rat Neprilysin ELISA Kit
EF017415 96 Tests
EUR 689
Bsg ELISA Kit| Rat Basigin ELISA Kit
EF017426 96 Tests
EUR 689
Nes ELISA Kit| Rat Nestin ELISA Kit
EF017458 96 Tests
EUR 689
Syp ELISA Kit| Rat Synaptophysin ELISA Kit
EF017459 96 Tests
EUR 689
Apln ELISA Kit| Rat Apelin ELISA Kit
EF017467 96 Tests
EUR 689
Kl ELISA Kit| Rat Klotho ELISA Kit
EF017474 96 Tests
EUR 689
Cubn ELISA Kit| Rat Cubilin ELISA Kit
EF017522 96 Tests
EUR 689
AGRN ELISA Kit| Rat Agrin ELISA Kit
EF017533 96 Tests
EUR 689
ANG ELISA Kit| Rat Angiogenin ELISA Kit
EF017540 96 Tests
EUR 689
AR ELISA Kit| Rat Amphiregulin ELISA Kit
EF017545 96 Tests
EUR 689
Arg ELISA Kit| Rat Arginase ELISA Kit
EF017546 96 Tests
EUR 689
BK ELISA Kit| Rat Bradykinin ELISA Kit
EF017564 96 Tests
EUR 689
CALU ELISA Kit| Rat Calumenin ELISA Kit
EF017589 96 Tests
EUR 689
CAM ELISA Kit| Rat Calmodulin ELISA Kit
EF017590 96 Tests
EUR 689
CAN ELISA Kit| Rat Calcineurin ELISA Kit
EF017592 96 Tests
EUR 689

Rat HEPH(Hephaestin) ELISA Kit