Rat HEPH(Hephaestin) ELISA Kit

Rat HEPH(Hephaestin) ELISA Kit

To Order Contact us: [email protected]

Rat Hephaestin (HEPH) ELISA Kit
RD-HEPH-Ra-96Tests	Reddot Biotech	96 Tests	EUR 775

Human Hephaestin (HEPH) ELISA Kit
DLR-HEPH-Hu-48T	DL Develop	48T	EUR 517
Should the Human Hephaestin (HEPH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Hephaestin (HEPH) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Hephaestin (HEPH) ELISA Kit
DLR-HEPH-Hu-96T	DL Develop	96T	EUR 673
Should the Human Hephaestin (HEPH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Hephaestin (HEPH) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Hephaestin (HEPH) ELISA Kit
RDR-HEPH-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Hephaestin (HEPH) ELISA Kit
RDR-HEPH-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Hephaestin (HEPH) ELISA Kit
RD-HEPH-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Hephaestin (HEPH) ELISA Kit
RD-HEPH-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Rat Hephaestin (HEPH) ELISA Kit
20-abx258621	Abbexa	EUR 7237.00 EUR 3855.00 EUR 895.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Rat Hephaestin, HEPH ELISA Kit
ELA-E0338r	Lifescience Market	96 Tests	EUR 886

Rat Hephaestin (HEPH) ELISA Kit
abx576700-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Rat Hephaestin (HEPH) ELISA Kit
QY-E11775	Qayee Biotechnology	96T	EUR 374

Rat Hephaestin (HEPH) ELISA Kit
SEH918Ra-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5124.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Hephaestin (HEPH) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Hephaestin (HEPH) in serum, plasma, tissue homogenates and other biological fluids.

Rat Hephaestin (HEPH) ELISA Kit
SEH918Ra-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 509.64
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Hephaestin (HEPH) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Hephaestin (HEPH) in serum, plasma, tissue homogenates and other biological fluids.

Rat Hephaestin (HEPH) ELISA Kit
SEH918Ra-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 685.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Hephaestin (HEPH) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Hephaestin (HEPH) in serum, plasma, tissue homogenates and other biological fluids.

Rat Hephaestin (HEPH) ELISA Kit
SEH918Ra-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2783.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Hephaestin (HEPH) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Hephaestin (HEPH) in serum, plasma, tissue homogenates and other biological fluids.

Rat Hephaestin (HEPH) ELISA Kit
4-SEH918Ra	Cloud-Clone	EUR 5175.00 EUR 2734.00 EUR 686.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Hephaestin elisa. Alternative names of the recognized antigen: CPL
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Hephaestin (HEPH) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Rat HEPH (Hephaestin)
ELK7588	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Hephaestin (HEPH). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Hephaestin (HEPH Show more
Description: A sandwich ELISA kit for detection of Hephaestin from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Rat Hephaestin (HEPH) CLIA Kit
20-abx495579	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Hephaestin (HEPH)ELISA Kit
201-12-2743	SunredBio	96 tests	EUR 440
This Hephaestin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Hephaestin (HEPH) ELISA Kit
20-abx151798	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Hephaestin (HEPH) ELISA Kit
abx253815-96tests	Abbexa	96 tests	EUR 754
Shipped within 5-12 working days.

Human Hephaestin, HEPH ELISA Kit
ELA-E0338h	Lifescience Market	96 Tests	EUR 824

Mouse Hephaestin, HEPH ELISA Kit
ELA-E0338m	Lifescience Market	96 Tests	EUR 865

Human HEPH/ Hephaestin ELISA Kit
E1113Hu	Sunlong	1 Kit	EUR 571

Human HEPH(Hephaestin) ELISA Kit
EH0859	FN Test	96T	EUR 567.6
Detection range: 78-5000 pg/ml Uniprot ID: Q9BQS7 Alias: HEPH/Hephaestin
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml

Human Hephaestin(HEPH) ELISA kit
CSB-EL010289HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Hephaestin (HEPH) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Hephaestin(HEPH) ELISA kit
1-CSB-EL010289HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Hephaestin(HEPH) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Hephaestin (HEPH) ELISA Kit
abx573980-96tests	Abbexa	96 tests	EUR 754
Shipped within 5-12 working days.

Mouse Hephaestin (HEPH) ELISA Kit
abx512644-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Hephaestin(HEPH)ELISA Kit
QY-E04878	Qayee Biotechnology	96T	EUR 361

Human Hephaestin (HEPH) ELISA Kit
SEH918Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Hephaestin (HEPH) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Hephaestin (HEPH) in serum, plasma, tissue homogenates and other biological fluids.

Human Hephaestin (HEPH) ELISA Kit
SEH918Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Hephaestin (HEPH) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Hephaestin (HEPH) in serum, plasma, tissue homogenates and other biological fluids.

Human Hephaestin (HEPH) ELISA Kit
SEH918Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Hephaestin (HEPH) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Hephaestin (HEPH) in serum, plasma, tissue homogenates and other biological fluids.

Human Hephaestin (HEPH) ELISA Kit
SEH918Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Hephaestin (HEPH) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Hephaestin (HEPH) in serum, plasma, tissue homogenates and other biological fluids.

Human Hephaestin (HEPH) ELISA Kit
4-SEH918Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Hephaestin elisa. Alternative names of the recognized antigen: CPL
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Hephaestin (HEPH) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Hephaestin (HEPH) Antibody
20-abx116845	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Hephaestin (HEPH) Antibody
abx037992-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Hephaestin (HEPH) Antibody
20-abx129183	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Hephaestin (HEPH) Antibody
20-abx172795	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Hephaestin (HEPH) Antibody
abx233831-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Hephaestin (HEPH) Antibody
20-abx322037	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Recombinant Hephaestin (HEPH)
4-RPH918Hu01	Cloud-Clone	EUR 458.40 EUR 226.00 EUR 1444.00 EUR 548.00 EUR 996.00 EUR 370.00 EUR 3460.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9BQS7 Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 42.1kDa Isoelectric Point: 5.4
Description: Recombinant Human Hephaestin expressed in: E.coli

ELISA kit for Human HEPH (Hephaestin)
E-EL-H2356	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's HEPH ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human HEPH. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Human HEPH (Hephaestin) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human HEPH (Hephaestin)
ELK4180	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Hephaestin (HEPH). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Hephaestin (HEPH Show more
Description: A sandwich ELISA kit for detection of Hephaestin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Hephaestin (HEPH) CLIA Kit
20-abx495578	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Hephaestin (HEPH) Protein
20-abx166543	Abbexa	EUR 648.00 EUR 272.00 EUR 1943.00 EUR 759.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Hephaestin (HEPH) Polyclonal Antibody (Human)
4-PAH918Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HEPH (Ala24~Cys366) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hephaestin (HEPH)

Hephaestin (HEPH) Polyclonal Antibody (Human), APC
4-PAH918Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HEPH (Ala24~Cys366) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hephaestin (HEPH). This antibody is labeled with APC.

Hephaestin (HEPH) Polyclonal Antibody (Human), Biotinylated
4-PAH918Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HEPH (Ala24~Cys366) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hephaestin (HEPH). This antibody is labeled with Biotin.

Hephaestin (HEPH) Polyclonal Antibody (Human), Cy3
4-PAH918Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HEPH (Ala24~Cys366) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hephaestin (HEPH). This antibody is labeled with Cy3.

Hephaestin (HEPH) Polyclonal Antibody (Human), FITC
4-PAH918Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HEPH (Ala24~Cys366) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hephaestin (HEPH). This antibody is labeled with FITC.

Hephaestin (HEPH) Polyclonal Antibody (Human), HRP
4-PAH918Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HEPH (Ala24~Cys366) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hephaestin (HEPH). This antibody is labeled with HRP.

Hephaestin (HEPH) Polyclonal Antibody (Human), PE
4-PAH918Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HEPH (Ala24~Cys366) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hephaestin (HEPH). This antibody is labeled with PE.

Hephaestin (HEPH) Polyclonal Antibody (Human), APC-Cy7
4-PAH918Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HEPH (Ala24~Cys366) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hephaestin (HEPH). This antibody is labeled with APC-Cy7.

HEPH ELISA Kit (Rat) (OKCD02537)
OKCD02537	Aviva Systems Biology	96 Wells	EUR 896
Description: Description of target: May function as a ferroxidase for ferrous (II) to ferric ion (III) conversion and may be involved in copper transport and homeostasis. Implicated in iron homeostasis and may mediate iron efflux associated to ferroportin 1. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.128 ng/mL

HEPH ELISA KIT|Human
EF000577	Lifescience Market	96 Tests	EUR 689

Hephaestin Antibody
DF13057	Affbiotech	200ul	EUR 304
Description: Hephaestin Antibody detects endogenous levels of Hephaestin.

anti-Hephaestin
YF-PA25419	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to Hephaestin

HEPH ELISA Kit (Human) (OKCD09126)
OKCD09126	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: May function as a ferroxidase for ferrous (II) to ferric ion (III) conversion and may be involved in copper transport and homeostasis. Implicated in iron homeostasis and may mediate iron efflux associated to ferroportin 1.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.59ng/mL

HEPH ELISA Kit (Mouse) (OKEH05855)
OKEH05855	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: May function as a ferroxidase for ferrous (II) to ferric ion (III) conversion and may be involved in copper transport and homeostasis. Implicated in iron homeostasis and may mediate iron efflux associated to ferroportin 1. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.7 pg/mL

Rat HEPH shRNA Plasmid
20-abx987425	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

HEPH antibody
70R-17721	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal HEPH antibody

HEPH antibody
31933-100ul	SAB	100ul	EUR 252

HEPH antibody
31933-50ul	SAB	50ul	EUR 187

HEPH antibody
70R-7345	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal HEPH antibody raised against the N terminal of HEPH

HEPH Antibody
1-CSB-PA010289ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against HEPH. Recognizes HEPH from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

HEPH Antibody
1-CSB-PA010289GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against HEPH. Recognizes HEPH from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

HEPH siRNA
20-abx902444	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

HEPH siRNA
20-abx919264	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

HEPH siRNA
20-abx919265	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Hephaestin Blocking Peptide
DF13057-BP	Affbiotech	1mg	EUR 195

anti- Hephaestin antibody
FNab03831	FN Test	100µg	EUR 505.25
Immunogen: hephaestin Uniprot ID: Q9BQS7 Research Area: Metabolism
Description: Antibody raised against Hephaestin

Anti-Hephaestin antibody
PAab03831	Lifescience Market	100 ug	EUR 355

Anti-Hephaestin (2D3)
YF-MA17020	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to Hephaestin

Heph ORF Vector (Rat) (pORF)
ORF068146	ABM	1.0 ug DNA	EUR 506

HEPH ELISA Kit (Human) : 96 Wells (OKEH00385)
OKEH00385	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: May function as a ferroxidase for ferrous (II) to ferric ion (III) conversion and may be involved in copper transport and homeostasis. Implicated in iron homeostasis and may mediate iron efflux associated to ferroportin 1.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 31 pg/mL

Mouse Hephaestin- like protein 1, Hephl1 ELISA KIT
ELI-31482m	Lifescience Market	96 Tests	EUR 865

Human Hephaestin- like protein 1, HEPHL1 ELISA KIT
ELI-07978h	Lifescience Market	96 Tests	EUR 824

HEPH Blocking Peptide
33R-6088	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HEPH antibody, catalog no. 70R-7345

HEPH cloning plasmid
CSB-CL010289HU-10ug	Cusabio	10ug	EUR 1232
Formulation: 10 μg plasmid + 200μl Glycerol Length: 3477 Sequence: atggagtcaggccacctcctctgggctctgctgttcatgcagtccttgtggcctcaactgactgatggagccactcgagtctactacctgggcatccgggatgtgcagtggaactatgctcccaagggaagaaatgtcatcacgaaccagcctctggacagtgacatagtggctt Show more
Description: A cloning plasmid for the HEPH gene.

Custom production of antibodies in 5 Rats using customer supplied antigen (std 63 days protocol)
RAT-5	Alpha Diagnostics	1	EUR 1138

Heph sgRNA CRISPR Lentivector set (Rat)
K7552401	ABM	3 x 1.0 ug	EUR 339

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

HEPH Polyclonal Conjugated Antibody
C31933	SAB	100ul	EUR 397

Human HEPH shRNA Plasmid
20-abx956595	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse HEPH shRNA Plasmid
20-abx970777	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Heph sgRNA CRISPR Lentivector (Rat) (Target 1)
K7552402	ABM	1.0 ug DNA	EUR 154

Heph sgRNA CRISPR Lentivector (Rat) (Target 2)
K7552403	ABM	1.0 ug DNA	EUR 154

Heph sgRNA CRISPR Lentivector (Rat) (Target 3)
K7552404	ABM	1.0 ug DNA	EUR 154

HEPH Protein Vector (Rat) (pPB-C-His)
PV272582	ABM	500 ng	EUR 1191

HEPH Protein Vector (Rat) (pPB-N-His)
PV272583	ABM	500 ng	EUR 1191

HEPH Protein Vector (Rat) (pPM-C-HA)
PV272584	ABM	500 ng	EUR 1191

HEPH Protein Vector (Rat) (pPM-C-His)
PV272585	ABM	500 ng	EUR 1191

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV200PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV205PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV220PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV225PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

HEPH ORF Vector (Human) (pORF)
ORF004854	ABM	1.0 ug DNA	EUR 95

Heph ORF Vector (Mouse) (pORF)
ORF047098	ABM	1.0 ug DNA	EUR 506

Heph ORF Vector (Mouse) (pORF)
ORF047099	ABM	1.0 ug DNA	EUR 506

Heph ORF Vector (Mouse) (pORF)
ORF047100	ABM	1.0 ug DNA	EUR 506

Heph ORF Vector (Mouse) (pORF)
ORF047101	ABM	1.0 ug DNA	EUR 506

HEPH Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV674617	ABM	1.0 ug DNA	EUR 1355

HEPH Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV674621	ABM	1.0 ug DNA	EUR 1355

HEPH Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV674622	ABM	1.0 ug DNA	EUR 1355

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS750A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS770A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS790A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Mouse Hephaestin (Hp) control/blocking peptide
HEPH11-P	Alpha Diagnostics	100 ug	EUR 164

Rabbit Anti-Mouse Hephaestin (Hp) antiserum
HEPH11-S	Alpha Diagnostics	100 ul	EUR 457

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]
CAS9LIG-KIT	SBI	1 Kit	EUR 153
Category: Cas9

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE620A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE622A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE624A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

Heph sgRNA CRISPR Lentivector set (Mouse)
K3851001	ABM	3 x 1.0 ug	EUR 339

HEPH sgRNA CRISPR Lentivector set (Human)
K0945101	ABM	3 x 1.0 ug	EUR 339

vWF Acty. Kit
ABP-ACT-KIT	Abpcorp	12 x 8 microwells	EUR 428

vWF Ant. Kit
ABP-TOT-KIT	Abpcorp	12 x 8 microwells	EUR 394

Heph sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K7552405	ABM	3 x 1.0 ug	EUR 376

hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9)
CAS620A-KIT	SBI	1 kit	EUR 2152
Category: Cas9
Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression)

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

PrecisionX Multiplex gRNA Cloning Kit
CAS9-GRNA-KIT	SBI	10 rxn	EUR 445
Category: Cas9

Rabbit Anti-Mouse Hephaestin (Hp) IgG, aff pure
HEPH11-A	Alpha Diagnostics	100 ug	EUR 482

mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1	SBI	5 reactions	EUR 1152
Category: Stem Cell Products

Monoclonal HEPH Antibody (monoclonal) (M01), Clone: 2D3
AMM05331G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human HEPH (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2D3. This antibody is applicable in WB, E

Heph sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3851002	ABM	1.0 ug DNA	EUR 154

Heph sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3851003	ABM	1.0 ug DNA	EUR 154

Heph sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3851004	ABM	1.0 ug DNA	EUR 154

HEPH sgRNA CRISPR Lentivector (Human) (Target 1)
K0945102	ABM	1.0 ug DNA	EUR 154

HEPH sgRNA CRISPR Lentivector (Human) (Target 2)
K0945103	ABM	1.0 ug DNA	EUR 154

HEPH sgRNA CRISPR Lentivector (Human) (Target 3)
K0945104	ABM	1.0 ug DNA	EUR 154

HEPH Protein Vector (Mouse) (pPB-C-His)
PV188390	ABM	500 ng	EUR 1065

HEPH Protein Vector (Mouse) (pPB-N-His)
PV188391	ABM	500 ng	EUR 1065

HEPH Protein Vector (Mouse) (pPM-C-HA)
PV188392	ABM	500 ng	EUR 1065

HEPH Protein Vector (Mouse) (pPM-C-His)
PV188393	ABM	500 ng	EUR 1065

HEPH Protein Vector (Mouse) (pPB-C-His)
PV188394	ABM	500 ng	EUR 1065

HEPH Protein Vector (Mouse) (pPB-N-His)
PV188395	ABM	500 ng	EUR 1065

HEPH Protein Vector (Mouse) (pPM-C-HA)
PV188396	ABM	500 ng	EUR 1065

HEPH Protein Vector (Mouse) (pPM-C-His)
PV188397	ABM	500 ng	EUR 1065

HEPH Protein Vector (Mouse) (pPB-C-His)
PV188398	ABM	500 ng	EUR 1065

HEPH Protein Vector (Mouse) (pPB-N-His)
PV188399	ABM	500 ng	EUR 1065

HEPH Protein Vector (Mouse) (pPM-C-HA)
PV188400	ABM	500 ng	EUR 1065

HEPH Protein Vector (Mouse) (pPM-C-His)
PV188401	ABM	500 ng	EUR 1065

HEPH Protein Vector (Mouse) (pPB-C-His)
PV188402	ABM	500 ng	EUR 1065

HEPH Protein Vector (Mouse) (pPB-N-His)
PV188403	ABM	500 ng	EUR 1065

HEPH Protein Vector (Mouse) (pPM-C-HA)
PV188404	ABM	500 ng	EUR 1065

HEPH Protein Vector (Mouse) (pPM-C-His)
PV188405	ABM	500 ng	EUR 1065

HEPH Protein Vector (Human) (pPB-C-His)
PV019413	ABM	500 ng	EUR 329

HEPH Protein Vector (Human) (pPB-N-His)
PV019414	ABM	500 ng	EUR 329

HEPH Protein Vector (Human) (pPM-C-HA)
PV019415	ABM	500 ng	EUR 329

HEPH Protein Vector (Human) (pPM-C-His)
PV019416	ABM	500 ng	EUR 329

Heph 3'UTR Luciferase Stable Cell Line
TU109455	ABM	1.0 ml	Ask for price

Heph 3'UTR Luciferase Stable Cell Line
TU205725	ABM	1.0 ml	Ask for price

Heph 3'UTR GFP Stable Cell Line
TU159455	ABM	1.0 ml	Ask for price

Heph 3'UTR GFP Stable Cell Line
TU255725	ABM	1.0 ml	Ask for price

HEPH 3'UTR GFP Stable Cell Line
TU059712	ABM	1.0 ml	EUR 1521

HEPH 3'UTR Luciferase Stable Cell Line
TU009712	ABM	1.0 ml	EUR 1521

Heph sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K7552406	ABM	1.0 ug DNA	EUR 167

Heph sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K7552407	ABM	1.0 ug DNA	EUR 167

Heph sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K7552408	ABM	1.0 ug DNA	EUR 167

HEPH Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV674618	ABM	1.0 ug DNA	EUR 1355

HEPH Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV674619	ABM	1.0 ug DNA	EUR 1413

HEPH Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV674620	ABM	1.0 ug DNA	EUR 1413

Mouse hephaestin-like protein 1 Zylkopen control/blocking peptide
ZYK11-P	Alpha Diagnostics	100 ug	EUR 164

Human hephaestin-like protein 1 Zylkopen control/blocking peptide
ZYK12-P	Alpha Diagnostics	100 ug	EUR 164

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1	SBI	25 ul each	EUR 627
Category: Exosomes

CLOuD9 Gene Expression Regulation Kit (includes 10 ug each of dCas9-PYL1 and dCas9-ABI1 lentivectors, and 100 ul of 0.5M Inducer Agent)
CASCL9-100A-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Rabbit Anti-Mouse hephaestin-like protein 1 Zylkopen IgG, aff pure
ZYK11-A	Alpha Diagnostics	100 ug	EUR 482

Rabbit Anti-Human hephaestin-like protein 1 Zylkopen IgG, aff pure
ZYK12-A	Alpha Diagnostics	100 ug	EUR 482

Heph sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3851005	ABM	3 x 1.0 ug	EUR 376

HEPH sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0945105	ABM	3 x 1.0 ug	EUR 376

AXYGEN® AXYPET® PRO STARTER KIT: 4 PIPETTORS, PLEXI STAND, SAMPLE TIPS
AP-STR-KIT-P	CORNING	1/pk	EUR 721
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Heph sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K3851006	ABM	1.0 ug DNA	EUR 167

Heph sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K3851007	ABM	1.0 ug DNA	EUR 167

Heph sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K3851008	ABM	1.0 ug DNA	EUR 167

HEPH sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K0945106	ABM	1.0 ug DNA	EUR 167

HEPH sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K0945107	ABM	1.0 ug DNA	EUR 167

HEPH sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K0945108	ABM	1.0 ug DNA	EUR 167

AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-1	CORNING	1/pk	EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-2	CORNING	1/pk	EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

/ Rat ELISA Kit
ELA-E0703r	Lifescience Market	96 Tests	EUR 886

/ Rat ELISA Kit
ELA-E1084r	Lifescience Market	96 Tests	EUR 886

Hcrt ELISA Kit| Rat Orexin ELISA Kit
EF016909	Lifescience Market	96 Tests	EUR 689

PI ELISA Kit| Rat Proinsulin ELISA Kit
EF016927	Lifescience Market	96 Tests	EUR 689

Cck ELISA Kit| Rat Cholecystokinin ELISA Kit
EF016928	Lifescience Market	96 Tests	EUR 689

ENK ELISA Kit| Rat enkephalin ELISA Kit
EF016935	Lifescience Market	96 Tests	EUR 689

GRN ELISA Kit| Rat Granulin ELISA Kit
EF016963	Lifescience Market	96 Tests	EUR 689

PRGN ELISA Kit| Rat progranulin ELISA Kit
EF016964	Lifescience Market	96 Tests	EUR 689

TPS ELISA Kit| Rat Tryptase ELISA Kit
EF016972	Lifescience Market	96 Tests	EUR 689

ADM ELISA Kit| Rat Adrenomedullin ELISA Kit
EF016976	Lifescience Market	96 Tests	EUR 689

Pnoc ELISA Kit| Rat Prepronociceptin ELISA Kit
EF016990	Lifescience Market	96 Tests	EUR 689

CORT ELISA Kit| Rat Corticosterone ELISA Kit
EF016992	Lifescience Market	96 Tests	EUR 689

Cort ELISA Kit| Rat Cortistatin ELISA Kit
EF016993	Lifescience Market	96 Tests	EUR 689

FN ELISA Kit| Rat Fibronectin ELISA Kit
EF017022	Lifescience Market	96 Tests	EUR 689

LN ELISA Kit| Rat Laminin ELISA Kit
EF017041	Lifescience Market	96 Tests	EUR 689

Lum ELISA Kit| Rat Lumican ELISA Kit
EF017042	Lifescience Market	96 Tests	EUR 689

Prl ELISA Kit| Rat Prolactin ELISA Kit
EF017060	Lifescience Market	96 Tests	EUR 689

Lep ELISA Kit| Rat Leptin ELISA Kit
EF017074	Lifescience Market	96 Tests	EUR 689

MPO ELISA Kit| Rat Myeloperoxidase ELISA Kit
EF017081	Lifescience Market	96 Tests	EUR 689

Sost ELISA Kit| Rat Sclerostin ELISA Kit
EF017094	Lifescience Market	96 Tests	EUR 689

Epo ELISA Kit| Rat Erythropoietin ELISA Kit
EF017100	Lifescience Market	96 Tests	EUR 689

Fst ELISA Kit| Rat Follistatin ELISA Kit
EF017105	Lifescience Market	96 Tests	EUR 689

TPO ELISA Kit| Rat Thrombopoietin ELISA Kit
EF017113	Lifescience Market	96 Tests	EUR 689

Clu ELISA Kit| Rat Clusterin ELISA Kit
EF017114	Lifescience Market	96 Tests	EUR 689

Cat ELISA Kit| Rat Catalase ELISA Kit
EF017151	Lifescience Market	96 Tests	EUR 689

Tg ELISA Kit| Rat Thyroglobulin ELISA Kit
EF017170	Lifescience Market	96 Tests	EUR 689

Nesfatin ELISA Kit| Rat Nesfatin ELISA Kit
EF017172	Lifescience Market	96 Tests	EUR 689

Nrn1 ELISA Kit| Rat Neuritin ELISA Kit
EF017193	Lifescience Market	96 Tests	EUR 689

Sst ELISA Kit| Rat Somatostatin ELISA Kit
EF017203	Lifescience Market	96 Tests	EUR 689

Gck ELISA Kit| Rat Glucokinase ELISA Kit
EF017211	Lifescience Market	96 Tests	EUR 689

Ttr ELISA Kit| Rat Transthyretin ELISA Kit
EF017224	Lifescience Market	96 Tests	EUR 689

Agt ELISA Kit| Rat Angiotensinogen ELISA Kit
EF017231	Lifescience Market	96 Tests	EUR 689

Hp ELISA Kit| Rat Haptoglobin ELISA Kit
EF017233	Lifescience Market	96 Tests	EUR 689

Trh ELISA Kit| Rat Prothyroliberin ELISA Kit
EF017238	Lifescience Market	96 Tests	EUR 689

Scgb1a1 ELISA Kit| Rat Uteroglobin ELISA Kit
EF017241	Lifescience Market	96 Tests	EUR 689

REN ELISA Kit| Rat Renin ELISA Kit
EF017245	Lifescience Market	96 Tests	EUR 689

Tnmd ELISA Kit| Rat Tenomodulin ELISA Kit
EF017252	Lifescience Market	96 Tests	EUR 689

Sct ELISA Kit| Rat Secretin ELISA Kit
EF017276	Lifescience Market	96 Tests	EUR 689

Calb1 ELISA Kit| Rat Calbindin ELISA Kit
EF017283	Lifescience Market	96 Tests	EUR 689

Rnls ELISA Kit| Rat Renalase ELISA Kit
EF017284	Lifescience Market	96 Tests	EUR 689

Ache ELISA Kit| Rat Acetylcholinesterase ELISA Kit
EF017303	Lifescience Market	96 Tests	EUR 689

GT ELISA Kit| Rat Gastrin ELISA Kit
EF017314	Lifescience Market	96 Tests	EUR 689

Plg ELISA Kit| Rat Plasminogen ELISA Kit
EF017317	Lifescience Market	96 Tests	EUR 689

Gc ELISA Kit| Rat Glucagon ELISA Kit
EF017328	Lifescience Market	96 Tests	EUR 689

Ocm ELISA Kit| Rat Oncomodulin ELISA Kit
EF017345	Lifescience Market	96 Tests	EUR 689

Eln ELISA Kit| Rat Elastin ELISA Kit
EF017346	Lifescience Market	96 Tests	EUR 689

Mme ELISA Kit| Rat Neprilysin ELISA Kit
EF017415	Lifescience Market	96 Tests	EUR 689

Bsg ELISA Kit| Rat Basigin ELISA Kit
EF017426	Lifescience Market	96 Tests	EUR 689

Nes ELISA Kit| Rat Nestin ELISA Kit
EF017458	Lifescience Market	96 Tests	EUR 689

Syp ELISA Kit| Rat Synaptophysin ELISA Kit
EF017459	Lifescience Market	96 Tests	EUR 689

Apln ELISA Kit| Rat Apelin ELISA Kit
EF017467	Lifescience Market	96 Tests	EUR 689

Kl ELISA Kit| Rat Klotho ELISA Kit
EF017474	Lifescience Market	96 Tests	EUR 689

Cubn ELISA Kit| Rat Cubilin ELISA Kit
EF017522	Lifescience Market	96 Tests	EUR 689

AGRN ELISA Kit| Rat Agrin ELISA Kit
EF017533	Lifescience Market	96 Tests	EUR 689

ANG ELISA Kit| Rat Angiogenin ELISA Kit
EF017540	Lifescience Market	96 Tests	EUR 689

AR ELISA Kit| Rat Amphiregulin ELISA Kit
EF017545	Lifescience Market	96 Tests	EUR 689

Arg ELISA Kit| Rat Arginase ELISA Kit
EF017546	Lifescience Market	96 Tests	EUR 689

Rat HEPH(Hephaestin) ELISA Kit