Rat HPD(4-Hydroxyphenylpyruvate Dioxygenase) ELISA Kit
To Order Contact us: [email protected]
Human 4-Hydroxyphenylpyruvate Dioxygenase (HPD) ELISA Kit |
RDR-HPD-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human 4-Hydroxyphenylpyruvate Dioxygenase (HPD) ELISA Kit |
RDR-HPD-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Rat 4 hydroxyphenylpyruvate dioxygenase(HPD) ELISA kit |
E02H1389-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat 4 hydroxyphenylpyruvate dioxygenase(HPD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat 4 hydroxyphenylpyruvate dioxygenase(HPD) ELISA kit |
E02H1389-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat 4 hydroxyphenylpyruvate dioxygenase(HPD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat 4 hydroxyphenylpyruvate dioxygenase(HPD) ELISA kit |
E02H1389-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat 4 hydroxyphenylpyruvate dioxygenase(HPD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat 4-Hydroxyphenylpyruvate Dioxygenase (HPD) ELISA Kit |
20-abx258095 |
Abbexa |
-
EUR 7237.00
-
EUR 3855.00
-
EUR 895.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Rat 4-Hydroxyphenylpyruvate Dioxygenase (HPD) ELISA Kit |
SEE251Ra-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5124.2 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat 4-Hydroxyphenylpyruvate Dioxygenase (HPD) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Ass
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat 4-Hydroxyphenylpyruvate Dioxygenase (HPD) in Tissue homogenates, cell lysates and other biological fluids. |
Rat 4-Hydroxyphenylpyruvate Dioxygenase (HPD) ELISA Kit |
SEE251Ra-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 509.64 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat 4-Hydroxyphenylpyruvate Dioxygenase (HPD) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Ass
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat 4-Hydroxyphenylpyruvate Dioxygenase (HPD) in Tissue homogenates, cell lysates and other biological fluids. |
Rat 4-Hydroxyphenylpyruvate Dioxygenase (HPD) ELISA Kit |
SEE251Ra-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 685.2 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat 4-Hydroxyphenylpyruvate Dioxygenase (HPD) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Ass
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat 4-Hydroxyphenylpyruvate Dioxygenase (HPD) in Tissue homogenates, cell lysates and other biological fluids. |
Rat 4-Hydroxyphenylpyruvate Dioxygenase (HPD) ELISA Kit |
SEE251Ra-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2783.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat 4-Hydroxyphenylpyruvate Dioxygenase (HPD) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Ass
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat 4-Hydroxyphenylpyruvate Dioxygenase (HPD) in Tissue homogenates, cell lysates and other biological fluids. |
Rat 4-Hydroxyphenylpyruvate Dioxygenase (HPD) ELISA Kit |
4-SEE251Ra |
Cloud-Clone |
-
EUR 5175.00
-
EUR 2734.00
-
EUR 686.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as 4-Hydroxyphenylpyruvate Dioxygenase elisa. Alternative names of the recognized antigen: PPD
- 4-HPPD
- 4HPPD
- GLOD3
- Glyoxalase Domain Containing 3
- 4-hydroxyphenylpyruvic acid oxidase
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat 4-Hydroxyphenylpyruvate Dioxygenase (HPD) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
4-Hydroxyphenylpyruvate Dioxygenase (HPD) Antibody |
20-abx129172 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
4-Hydroxyphenylpyruvate Dioxygenase (HPD) Antibody |
20-abx002859 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
4-Hydroxyphenylpyruvate Dioxygenase (HPD) Antibody |
20-abx171017 |
Abbexa |
-
EUR 342.00
-
EUR 857.00
-
EUR 439.00
-
EUR 154.00
-
EUR 258.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
4-Hydroxyphenylpyruvate Dioxygenase (HPD) Antibody |
abx145589-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
4-Hydroxyphenylpyruvate Dioxygenase (HPD) Antibody |
abx034014-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
4-Hydroxyphenylpyruvate Dioxygenase (HPD) Antibody |
abx034014-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
4-Hydroxyphenylpyruvate Dioxygenase (HPD) Antibody |
20-abx004989 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
4-Hydroxyphenylpyruvate Dioxygenase (HPD) Antibody |
abx233993-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Human 4-hydroxyphenylpyruvate dioxygenase (HPD) |
1-CSB-EP010698HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 48.8 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human 4-hydroxyphenylpyruvate dioxygenase(HPD) expressed in E.coli |
Recombinant 4-Hydroxyphenylpyruvate Dioxygenase (HPD) |
4-RPE251Hu01 |
Cloud-Clone |
-
EUR 474.53
-
EUR 230.00
-
EUR 1504.48
-
EUR 568.16
-
EUR 1036.32
-
EUR 380.00
-
EUR 3611.20
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P32754
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 48.5kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human 4-Hydroxyphenylpyruvate Dioxygenase expressed in: E.coli |
Rat 4-Hydroxyphenylpyruvate Dioxygenase (HPD) CLIA Kit |
20-abx494554 |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Goat 4 hydroxyphenylpyruvate dioxygenase(HPD) ELISA kit |
E06H1389-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat 4 hydroxyphenylpyruvate dioxygenase(HPD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat 4 hydroxyphenylpyruvate dioxygenase(HPD) ELISA kit |
E06H1389-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat 4 hydroxyphenylpyruvate dioxygenase(HPD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat 4 hydroxyphenylpyruvate dioxygenase(HPD) ELISA kit |
E06H1389-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat 4 hydroxyphenylpyruvate dioxygenase(HPD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse 4 hydroxyphenylpyruvate dioxygenase(HPD) ELISA kit |
E03H1389-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse 4 hydroxyphenylpyruvate dioxygenase(HPD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse 4 hydroxyphenylpyruvate dioxygenase(HPD) ELISA kit |
E03H1389-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse 4 hydroxyphenylpyruvate dioxygenase(HPD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse 4 hydroxyphenylpyruvate dioxygenase(HPD) ELISA kit |
E03H1389-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse 4 hydroxyphenylpyruvate dioxygenase(HPD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit 4 hydroxyphenylpyruvate dioxygenase(HPD) ELISA kit |
E04H1389-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit 4 hydroxyphenylpyruvate dioxygenase(HPD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit 4 hydroxyphenylpyruvate dioxygenase(HPD) ELISA kit |
E04H1389-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit 4 hydroxyphenylpyruvate dioxygenase(HPD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit 4 hydroxyphenylpyruvate dioxygenase(HPD) ELISA kit |
E04H1389-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit 4 hydroxyphenylpyruvate dioxygenase(HPD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human 4 hydroxyphenylpyruvate dioxygenase(HPD) ELISA kit |
E01H1389-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human 4 hydroxyphenylpyruvate dioxygenase(HPD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human 4 hydroxyphenylpyruvate dioxygenase(HPD) ELISA kit |
E01H1389-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human 4 hydroxyphenylpyruvate dioxygenase(HPD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human 4 hydroxyphenylpyruvate dioxygenase(HPD) ELISA kit |
E01H1389-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human 4 hydroxyphenylpyruvate dioxygenase(HPD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog 4 hydroxyphenylpyruvate dioxygenase(HPD) ELISA kit |
E08H1389-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine 4 hydroxyphenylpyruvate dioxygenase(HPD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog 4 hydroxyphenylpyruvate dioxygenase(HPD) ELISA kit |
E08H1389-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine 4 hydroxyphenylpyruvate dioxygenase(HPD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog 4 hydroxyphenylpyruvate dioxygenase(HPD) ELISA kit |
E08H1389-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine 4 hydroxyphenylpyruvate dioxygenase(HPD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig 4 hydroxyphenylpyruvate dioxygenase(HPD) ELISA kit |
E07H1389-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine 4 hydroxyphenylpyruvate dioxygenase(HPD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig 4 hydroxyphenylpyruvate dioxygenase(HPD) ELISA kit |
E07H1389-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine 4 hydroxyphenylpyruvate dioxygenase(HPD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig 4 hydroxyphenylpyruvate dioxygenase(HPD) ELISA kit |
E07H1389-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine 4 hydroxyphenylpyruvate dioxygenase(HPD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Porcine 4- hydroxyphenylpyruvate dioxygenase, HPD ELISA KIT |
ELI-08367p |
Lifescience Market |
96 Tests |
EUR 928 |
Mouse 4- hydroxyphenylpyruvate dioxygenase, Hpd ELISA KIT |
ELI-27106m |
Lifescience Market |
96 Tests |
EUR 865 |
Bovine 4- hydroxyphenylpyruvate dioxygenase, HPD ELISA KIT |
ELI-27791b |
Lifescience Market |
96 Tests |
EUR 928 |
Monkey 4 hydroxyphenylpyruvate dioxygenase(HPD) ELISA kit |
E09H1389-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey 4 hydroxyphenylpyruvate dioxygenase(HPD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey 4 hydroxyphenylpyruvate dioxygenase(HPD) ELISA kit |
E09H1389-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey 4 hydroxyphenylpyruvate dioxygenase(HPD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey 4 hydroxyphenylpyruvate dioxygenase(HPD) ELISA kit |
E09H1389-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey 4 hydroxyphenylpyruvate dioxygenase(HPD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human 4- hydroxyphenylpyruvate dioxygenase, HPD ELISA KIT |
ELI-38638h |
Lifescience Market |
96 Tests |
EUR 824 |
Human 4-Hydroxyphenylpyruvate Dioxygenase (HPD) ELISA Kit |
20-abx151838 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human 4-Hydroxyphenylpyruvate Dioxygenase (HPD) ELISA Kit |
20-abx258754 |
Abbexa |
-
EUR 7112.00
-
EUR 3792.00
-
EUR 879.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Mouse 4-hydroxyphenylpyruvate Dioxygenase (HPD) ELISA Kit |
abx388466-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human 4-Hydroxyphenylpyruvate Dioxygenase (HPD) ELISA Kit |
SEE251Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human 4-Hydroxyphenylpyruvate Dioxygenase (HPD) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-A
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human 4-Hydroxyphenylpyruvate Dioxygenase (HPD) in serum, plasma, tissue homogenates and other biological fluids. |
Human 4-Hydroxyphenylpyruvate Dioxygenase (HPD) ELISA Kit |
SEE251Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human 4-Hydroxyphenylpyruvate Dioxygenase (HPD) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-A
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human 4-Hydroxyphenylpyruvate Dioxygenase (HPD) in serum, plasma, tissue homogenates and other biological fluids. |
Human 4-Hydroxyphenylpyruvate Dioxygenase (HPD) ELISA Kit |
SEE251Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human 4-Hydroxyphenylpyruvate Dioxygenase (HPD) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-A
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human 4-Hydroxyphenylpyruvate Dioxygenase (HPD) in serum, plasma, tissue homogenates and other biological fluids. |
Human 4-Hydroxyphenylpyruvate Dioxygenase (HPD) ELISA Kit |
SEE251Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human 4-Hydroxyphenylpyruvate Dioxygenase (HPD) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-A
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human 4-Hydroxyphenylpyruvate Dioxygenase (HPD) in serum, plasma, tissue homogenates and other biological fluids. |
Human 4-Hydroxyphenylpyruvate Dioxygenase (HPD) ELISA Kit |
4-SEE251Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as 4-Hydroxyphenylpyruvate Dioxygenase elisa. Alternative names of the recognized antigen: PPD
- 4-HPPD
- 4HPPD
- GLOD3
- Glyoxalase Domain Containing 3
- 4-hydroxyphenylpyruvic acid oxidase
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human 4-Hydroxyphenylpyruvate Dioxygenase (HPD) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species. |
ELISA kit for Rat HPD (4-Hydroxyphenylpyruvate Dioxygenase) |
ELK7426 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to 4-Hydroxyphenylpyruvate Dioxygenase (HPD). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody spec
- Show more
|
Description: A sandwich ELISA kit for detection of 4-Hydroxyphenylpyruvate Dioxygenase from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
4-Hydroxyphenylpyruvate Dioxygenase (HPD) Antibody Pair |
abx117627-1pair5x96wellplates |
Abbexa |
1 pair (5x96 well plates) |
EUR 1010 |
- Shipped within 5-10 working days.
|
Human 4-Hydroxyphenylpyruvate Dioxygenase (HPD) Protein |
20-abx166636 |
Abbexa |
-
EUR 662.00
-
EUR 272.00
-
EUR 2026.00
-
EUR 787.00
-
EUR 481.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Human 4-Hydroxyphenylpyruvate Dioxygenase (HPD) Protein |
abx060043-100ug |
Abbexa |
100 ug |
EUR 328 |
- Shipped within 5-10 working days.
|
4-Hydroxyphenylpyruvate Dioxygenase (HPD) Antibody (Biotin) |
20-abx105067 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
4-Hydroxyphenylpyruvate Dioxygenase (HPD) Antibody (FITC) |
20-abx106482 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
4-Hydroxyphenylpyruvate Dioxygenase (HPD) Antibody (HRP) |
20-abx107901 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Hpd ELISA Kit| Rat 4-hydroxyphenylpyruvate dioxygenase ELISA Ki |
EF018255 |
Lifescience Market |
96 Tests |
EUR 689 |
Hpd ELISA Kit| Mouse 4-hydroxyphenylpyruvate dioxygenase ELISA |
EF014089 |
Lifescience Market |
96 Tests |
EUR 689 |
HPD ELISA Kit| Bovine 4-hydroxyphenylpyruvate dioxygenase ELISA |
EF011066 |
Lifescience Market |
96 Tests |
EUR 689 |
Human 4-Hydroxyphenylpyruvate Dioxygenase (HPD) CLIA Kit |
20-abx494553 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Guinea pig 4 hydroxyphenylpyruvate dioxygenase(HPD) ELISA kit |
E05H1389-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig 4 hydroxyphenylpyruvate dioxygenase(HPD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig 4 hydroxyphenylpyruvate dioxygenase(HPD) ELISA kit |
E05H1389-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig 4 hydroxyphenylpyruvate dioxygenase(HPD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig 4 hydroxyphenylpyruvate dioxygenase(HPD) ELISA kit |
E05H1389-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig 4 hydroxyphenylpyruvate dioxygenase(HPD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
ELISA kit for Human HPD (4-Hydroxyphenylpyruvate Dioxygenase) |
ELK3809 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to 4-Hydroxyphenylpyruvate Dioxygenase (HPD). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody spec
- Show more
|
Description: A sandwich ELISA kit for detection of 4-Hydroxyphenylpyruvate Dioxygenase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
HPD 4-Hydroxyphenylpyruvate Dioxygenase Human Recombinant Protein |
PROTP32754 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: HPD produced in E.Coli is a single, non-glycosylated polypeptide chain containing 413 amino acids (1-393a.a.) and having a molecular mass of 47kDa.;HPD is fused to a 20 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques. |
Human Wide-range 4-Hydroxyphenylpyruvate Dioxygenase ELISA Kit (HPD) |
RK01582 |
Abclonal |
96 Tests |
EUR 521 |
Wide-range Human 4-Hydroxyphenylpyruvate Dioxygenase (HPD) ELISA Kit |
WEE251Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4502.43 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Wide-range Human 4-Hydroxyphenylpyruvate Dioxygenase (HPD) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<1
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Wide-range Human 4-Hydroxyphenylpyruvate Dioxygenase (HPD) in serum, plasma, tissue homogenates and other biological fluids. |
Wide-range Human 4-Hydroxyphenylpyruvate Dioxygenase (HPD) ELISA Kit |
WEE251Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 458.44 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Wide-range Human 4-Hydroxyphenylpyruvate Dioxygenase (HPD) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<1
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Wide-range Human 4-Hydroxyphenylpyruvate Dioxygenase (HPD) in serum, plasma, tissue homogenates and other biological fluids. |
Wide-range Human 4-Hydroxyphenylpyruvate Dioxygenase (HPD) ELISA Kit |
WEE251Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 612.05 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Wide-range Human 4-Hydroxyphenylpyruvate Dioxygenase (HPD) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<1
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Wide-range Human 4-Hydroxyphenylpyruvate Dioxygenase (HPD) in serum, plasma, tissue homogenates and other biological fluids. |
Wide-range Human 4-Hydroxyphenylpyruvate Dioxygenase (HPD) ELISA Kit |
WEE251Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2454.23 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Wide-range Human 4-Hydroxyphenylpyruvate Dioxygenase (HPD) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<1
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Wide-range Human 4-Hydroxyphenylpyruvate Dioxygenase (HPD) in serum, plasma, tissue homogenates and other biological fluids. |
Wide-range Human 4-Hydroxyphenylpyruvate Dioxygenase (HPD) ELISA Kit |
4-WEE251Hu |
Cloud-Clone |
-
EUR 4553.00
-
EUR 2405.00
-
EUR 613.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as 4-Hydroxyphenylpyruvate Dioxygenase elisa. Alternative names of the recognized antigen: PPD
- 4-HPPD
- 4HPPD
- GLOD3
- Glyoxalase Domain Containing 3
- 4-hydroxyphenylpyruvic acid oxidase
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Wide-range Human 4-Hydroxyphenylpyruvate Dioxygenase (HPD) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species. |
4-Hydroxyphenylpyruvate Dioxygenase (HPD) Polyclonal Antibody (Human, Pig) |
4-PAE251Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HPD (Thr2~Met393 )
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Pig 4-Hydroxyphenylpyruvate Dioxygenase (HPD) |
Human Wide-range 4-Hydroxyphenylpyruvate Dioxygenase (HPD) CLIA Kit |
20-abx496342 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
4-Hydroxyphenylpyruvate Dioxygenase (HPD) Polyclonal Antibody (Human, Pig), APC |
4-PAE251Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HPD (Thr2~Met393 )
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Pig 4-Hydroxyphenylpyruvate Dioxygenase (HPD). This antibody is labeled with APC. |
4-Hydroxyphenylpyruvate Dioxygenase (HPD) Polyclonal Antibody (Human, Pig), Biotinylated |
4-PAE251Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HPD (Thr2~Met393 )
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Pig 4-Hydroxyphenylpyruvate Dioxygenase (HPD). This antibody is labeled with Biotin. |
4-Hydroxyphenylpyruvate Dioxygenase (HPD) Polyclonal Antibody (Human, Pig), Cy3 |
4-PAE251Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HPD (Thr2~Met393 )
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Pig 4-Hydroxyphenylpyruvate Dioxygenase (HPD). This antibody is labeled with Cy3. |
4-Hydroxyphenylpyruvate Dioxygenase (HPD) Polyclonal Antibody (Human, Pig), FITC |
4-PAE251Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HPD (Thr2~Met393 )
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Pig 4-Hydroxyphenylpyruvate Dioxygenase (HPD). This antibody is labeled with FITC. |
4-Hydroxyphenylpyruvate Dioxygenase (HPD) Polyclonal Antibody (Human, Pig), HRP |
4-PAE251Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HPD (Thr2~Met393 )
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Pig 4-Hydroxyphenylpyruvate Dioxygenase (HPD). This antibody is labeled with HRP. |
4-Hydroxyphenylpyruvate Dioxygenase (HPD) Polyclonal Antibody (Human, Pig), PE |
4-PAE251Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HPD (Thr2~Met393 )
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Pig 4-Hydroxyphenylpyruvate Dioxygenase (HPD). This antibody is labeled with PE. |
4-Hydroxyphenylpyruvate Dioxygenase (Recombinant) |
20-abx073678 |
Abbexa |
-
EUR 328.00
-
EUR 6397.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
4-Hydroxyphenylpyruvate Dioxygenase (HPD) Polyclonal Antibody (Human, Pig), APC-Cy7 |
4-PAE251Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HPD (Thr2~Met393 )
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Pig 4-Hydroxyphenylpyruvate Dioxygenase (HPD). This antibody is labeled with APC-Cy7. |
Rat 4-hydroxyphenylpyruvate Dioxygenase Like (HPDL) ELISA Kit |
abx390904-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
4-Hydroxyphenylpyruvate Dioxygenase (4-HPPD) Antibody |
20-abx109463 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
4-Hydroxyphenylpyruvate Dioxygenase (4-HPPD) Antibody |
20-abx110721 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Recombinant Human 4-Hydroxyphenylpyruvate Dioxygenase |
7-02971 |
CHI Scientific |
2µg |
Ask for price |
Recombinant Human 4-Hydroxyphenylpyruvate Dioxygenase |
7-02972 |
CHI Scientific |
10µg |
Ask for price |
Recombinant Human 4-Hydroxyphenylpyruvate Dioxygenase |
7-02973 |
CHI Scientific |
1mg |
Ask for price |
4-hydroxyphenylpyruvate dioxygenase Polyclonal Antibody |
42213-100ul |
SAB |
100ul |
EUR 333 |
Hpdl ELISA Kit| Rat 4-hydroxyphenylpyruvate dioxygenase-like pr |
EF018256 |
Lifescience Market |
96 Tests |
EUR 689 |
Hpdl ELISA Kit| Mouse 4-hydroxyphenylpyruvate dioxygenase-like |
EF014090 |
Lifescience Market |
96 Tests |
EUR 689 |
Mouse 4-hydroxyphenylpyruvate Dioxygenase Like (HPDL) ELISA Kit |
abx388467-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
4-hydroxyphenylpyruvate dioxygenase Polyclonal Conjugated Antibody |
C42213 |
SAB |
100ul |
EUR 397 |
Human 4-Hydroxyphenylpyruvate Dioxygenase-Like Protein (HPDL) ELISA Kit |
abx387871-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
4-Hydroxyphenylpyruvate Dioxygenase-Like Protein (HPDL) Antibody |
20-abx110722 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
4-Hydroxyphenylpyruvate Dioxygenase-Like Protein (HPDL) Antibody |
abx233994-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Recombinant Human 4-Hydroxyphenylpyruvate Dioxygenase/4HPPD/HPPDase (N-6His) |
CE50-10ug |
Novoprotein |
10ug |
EUR 202 |
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 50mM NaCl, 1mM DTT, 0.1mM PMSF, pH 8.0. |
Recombinant Human 4-Hydroxyphenylpyruvate Dioxygenase/4HPPD/HPPDase (N-6His) |
CE50-1mg |
Novoprotein |
1mg |
EUR 2283 |
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 50mM NaCl, 1mM DTT, 0.1mM PMSF, pH 8.0. |
Recombinant Human 4-Hydroxyphenylpyruvate Dioxygenase/4HPPD/HPPDase (N-6His) |
CE50-500ug |
Novoprotein |
500ug |
EUR 1613 |
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 50mM NaCl, 1mM DTT, 0.1mM PMSF, pH 8.0. |
Recombinant Human 4-Hydroxyphenylpyruvate Dioxygenase/4HPPD/HPPDase (N-6His) |
CE50-50ug |
Novoprotein |
50ug |
EUR 496 |
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 50mM NaCl, 1mM DTT, 0.1mM PMSF, pH 8.0. |
Recombinant Human 4-hydroxyphenylpyruvate dioxygenase Protein, His, E.coli-100ug |
QP6179-ec-100ug |
EnQuireBio |
100ug |
EUR 408 |
Recombinant Human 4-hydroxyphenylpyruvate dioxygenase Protein, His, E.coli-10ug |
QP6179-ec-10ug |
EnQuireBio |
10ug |
EUR 200 |
Recombinant Human 4-hydroxyphenylpyruvate dioxygenase Protein, His, E.coli-1mg |
QP6179-ec-1mg |
EnQuireBio |
1mg |
EUR 1632 |
Recombinant Human 4-hydroxyphenylpyruvate dioxygenase Protein, His, E.coli-200ug |
QP6179-ec-200ug |
EnQuireBio |
200ug |
EUR 634 |
Recombinant Human 4-hydroxyphenylpyruvate dioxygenase Protein, His, E.coli-500ug |
QP6179-ec-500ug |
EnQuireBio |
500ug |
EUR 1060 |
Recombinant Human 4-hydroxyphenylpyruvate dioxygenase Protein, His, E.coli-50ug |
QP6179-ec-50ug |
EnQuireBio |
50ug |
EUR 263 |
Hpd ELISA Kit (Rat) (OKCD01816) |
OKCD01816 |
Aviva Systems Biology |
96 Wells |
EUR 896 |
Description: Description of target: Key enzyme in the degradation of tyrosine. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 1.35 ng/mL |
Rat Methylcytosine dioxygenase ELISA kit |
E02T0868-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Methylcytosine dioxygenase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Methylcytosine dioxygenase ELISA kit |
E02T0868-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Methylcytosine dioxygenase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Methylcytosine dioxygenase ELISA kit |
E02T0868-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Methylcytosine dioxygenase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
HPD ELISA Kit (Human) (OKCD01234) |
OKCD01234 |
Aviva Systems Biology |
96 Wells |
EUR 831 |
Description: Description of target: Key enzyme in the degradation of tyrosine. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.32 ng/mL |
HPD ELISA Kit (Human) (OKCD09576) |
OKCD09576 |
Aviva Systems Biology |
96 Wells |
EUR 936 |
Description: Description of target: The protein encoded by this gene is an enzyme in the catabolic pathway of tyrosine. The encoded protein catalyzes the conversion of 4-hydroxyphenylpyruvate to homogentisate. Defects in this gene are a cause of tyrosinemia type 3 (TYRO3) and hawkinsinuria ;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 1.13ng/mL |
Liver Dissociation System 4 (Hepatocytes, rat), Rat |
4-20304 |
CHI Scientific |
ea |
Ask for price |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
Rat HPD shRNA Plasmid |
20-abx985565 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
HPD Recombinant Protein (Rat) |
RP205010 |
ABM |
100 ug |
Ask for price |
Rat FibrOut 4, for brain, neural |
4-20533 |
CHI Scientific |
1 ml |
Ask for price |
Rat FibrOut 4, for brain, neural |
4-20534 |
CHI Scientific |
5 x 1 ml |
Ask for price |
Rat Indoleamine 2,3 Dioxygenase ELISA kit |
E02I0057-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Indoleamine 2,3 Dioxygenase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Indoleamine 2,3 Dioxygenase ELISA kit |
E02I0057-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Indoleamine 2,3 Dioxygenase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Indoleamine 2,3 Dioxygenase ELISA kit |
E02I0057-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Indoleamine 2,3 Dioxygenase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Tryptophan 2,3 dioxygenase ELISA kit |
E02T0142-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Tryptophan 2,3 dioxygenase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Tryptophan 2,3 dioxygenase ELISA kit |
E02T0142-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Tryptophan 2,3 dioxygenase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Tryptophan 2,3 dioxygenase ELISA kit |
E02T0142-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Tryptophan 2,3 dioxygenase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
HPD siRNA |
20-abx902519 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
HPD siRNA |
20-abx919810 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
HPD siRNA |
20-abx919811 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
HPD antibody |
70R-2553 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal HPD antibody raised against the middle region of HPD |
HPD antibody |
38968-100ul |
SAB |
100ul |
EUR 252 |
HPD Antibody |
43066-100ul |
SAB |
100ul |
EUR 252 |
HPD antibody |
70R-17799 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal HPD antibody |
HPD Antibody |
DF8303 |
Affbiotech |
200ul |
EUR 304 |
Description: HPD Antibody detects endogenous levels of total HPD. |
HPD Antibody |
1-CSB-PA010698GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against HPD. Recognizes HPD from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
HPD Antibody |
1-CSB-PA010698LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against HPD. Recognizes HPD from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200 |
Thymus Dissociation System 4 (Epithelial), Adult rat |
4-20444 |
CHI Scientific |
ea |
Ask for price |
Cartilage Dissociation System 4 (Chondrocytes), Mouse and Rat |
4-20234 |
CHI Scientific |
ea |
Ask for price |
Pancreas Dissociation System 4 (Islets), Mouse and Rat |
4-20374 |
CHI Scientific |
ea |
Ask for price |
Skin Dissociation System 4 (Keratinocytes), Mouse and Rat |
4-20434 |
CHI Scientific |
ea |
Ask for price |
Hpd ORF Vector (Rat) (pORF) |
ORF068338 |
ABM |
1.0 ug DNA |
EUR 506 |
IL-4 Interleukin 4 Human Recombinant Protein, Yeast |
PROTP05112-4 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: Interleukin-4 Human Recombinant produced in yeast is a single, glycosylated polypeptide chain containing 129 amino acids.;The IL-4 is purified by proprietary chromatographic techniques. |
Rat Trimethyllysine Dioxygenase, Mitochondrial (TMLHE) ELISA Kit |
abx550466-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 1-2 months.
|
Rat Tryptophan 2,3-Dioxygenase (TDO2) ELISA Kit |
abx556252-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 1-3 weeks.
|
Rat Trimethyllysine dioxygenase, mitochondrial(TMLHE) ELISA kit |
E02T0716-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Trimethyllysine dioxygenase, mitochondrial(TMLHE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Trimethyllysine dioxygenase, mitochondrial(TMLHE) ELISA kit |
E02T0716-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Trimethyllysine dioxygenase, mitochondrial(TMLHE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Trimethyllysine dioxygenase, mitochondrial(TMLHE) ELISA kit |
E02T0716-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Trimethyllysine dioxygenase, mitochondrial(TMLHE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Tmlhe ELISA Kit| Rat Trimethyllysine dioxygenase, mitochondrial |
EF019435 |
Lifescience Market |
96 Tests |
EUR 689 |
Rat indoleamine 2,3-dioxygenase(IDO)ELISA Kit |
GA-E0738RT-48T |
GenAsia Biotech |
48T |
EUR 317 |
Rat indoleamine 2,3-dioxygenase(IDO)ELISA Kit |
GA-E0738RT-96T |
GenAsia Biotech |
96T |
EUR 496 |
Rat Indoleamine-2,3-Dioxygenase (IDO) ELISA Kit |
20-abx155665 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Rat Gamma-Butyrobetaine Dioxygenase (BBOX1) ELISA Kit |
abx391045-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Rat Indoleamine-2,3-Dioxygenase (IDO) ELISA Kit |
DLR-IDO-Ra-48T |
DL Develop |
48T |
EUR 528 |
- Should the Rat Indoleamine-2,3-Dioxygenase (IDO) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Indoleamine-2,3-Dioxygenase (IDO) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Rat Indoleamine-2,3-Dioxygenase (IDO) ELISA Kit |
DLR-IDO-Ra-96T |
DL Develop |
96T |
EUR 690 |
- Should the Rat Indoleamine-2,3-Dioxygenase (IDO) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Indoleamine-2,3-Dioxygenase (IDO) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Rat Indoleamine-2,3-Dioxygenase (IDO) ELISA Kit |
SEB547Ra-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4875.49 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Indoleamine-2,3-Dioxygenase (IDO) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<1
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Indoleamine-2,3-Dioxygenase (IDO) in serum, plasma, tissue homogenates and other biological fluids. |
Rat Indoleamine-2,3-Dioxygenase (IDO) ELISA Kit |
SEB547Ra-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 489.16 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Indoleamine-2,3-Dioxygenase (IDO) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<1
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Indoleamine-2,3-Dioxygenase (IDO) in serum, plasma, tissue homogenates and other biological fluids. |
Rat Indoleamine-2,3-Dioxygenase (IDO) ELISA Kit |
SEB547Ra-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 655.94 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Indoleamine-2,3-Dioxygenase (IDO) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<1
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Indoleamine-2,3-Dioxygenase (IDO) in serum, plasma, tissue homogenates and other biological fluids. |
Rat Indoleamine-2,3-Dioxygenase (IDO) ELISA Kit |
SEB547Ra-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2651.73 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Indoleamine-2,3-Dioxygenase (IDO) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<1
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Indoleamine-2,3-Dioxygenase (IDO) in serum, plasma, tissue homogenates and other biological fluids. |
Rat Indoleamine-2,3-Dioxygenase (IDO) ELISA Kit |
RD-IDO-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 534 |
Rat Indoleamine-2,3-Dioxygenase (IDO) ELISA Kit |
RD-IDO-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 742 |
Rat Indoleamine-2,3-Dioxygenase (IDO) ELISA Kit |
RDR-IDO-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 558 |
Rat Indoleamine-2,3-Dioxygenase (IDO) ELISA Kit |
RDR-IDO-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 776 |
Custom production of antibodies in 5 Rats using customer supplied antigen (std 63 days protocol) |
RAT-5 |
Alpha Diagnostics |
1 |
EUR 1138 |
Adipose/Fat Dissociation System 4 (Predipocytes), Mouse and Rat |
4-20194 |
CHI Scientific |
ea |
Ask for price |
Brain Dissociation System 4 (Endothelial, Microvessels), Mouse and Rat |
4-20224 |
CHI Scientific |
ea |
Ask for price |
Endothelial Dissociation System 4 (Endothelial,Cerebral), Mouse and Rat |
4-20244 |
CHI Scientific |
ea |
Ask for price |
Heart Dissociation System 4 (Myocytes,Ventricles), Mouse and Rat |
4-20274 |
CHI Scientific |
ea |
Ask for price |
Muscle Dissociation System 4 (Smooth muscle), Mouse and Rat |
4-20334 |
CHI Scientific |
ea |
Ask for price |
Parotid Dissociation System 4 (Parotid acinar), Mouse and Rat |
4-20394 |
CHI Scientific |
ea |
Ask for price |
Bbox1 ELISA Kit| Rat Gamma-butyrobetaine dioxygenase ELISA Kit |
EF018398 |
Lifescience Market |
96 Tests |
EUR 689 |
Tdo2 ELISA Kit| Rat Tryptophan 2,3-dioxygenase ELISA Kit |
EF019440 |
Lifescience Market |
96 Tests |
EUR 689 |
Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit |
DLR-CA72-4-Hu-48T |
DL Develop |
48T |
EUR 479 |
- Should the Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Carbohydrate Antigen 72-4 (CA72-4) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit |
DLR-CA72-4-Hu-96T |
DL Develop |
96T |
EUR 621 |
- Should the Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Carbohydrate Antigen 72-4 (CA72-4) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit |
RD-CA72-4-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 478 |
Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit |
RD-CA72-4-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 662 |
Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit |
RDR-CA72-4-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit |
RDR-CA72-4-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
Epithelial Dissociation System 4 (Epithelial,Submandibular salivary), Mouse and Rat |
4-20254 |
CHI Scientific |
ea |
Ask for price |
Heart Dissociation System 4 (Retinal pigment epithelial), Mouse and Rat |
4-20294 |
CHI Scientific |
ea |
Ask for price |
Lung Dissociation System 4 (Alveolar type II), Mouse and Rat |
4-20314 |
CHI Scientific |
ea |
Ask for price |
Reproductive Tissue Dissociation System 4 (Epithelial, vagina), Mouse and Rat |
4-20414 |
CHI Scientific |
ea |
Ask for price |
Individual Reaction Mix 4 |
G065-4 |
ABM |
200 reactions |
EUR 167 |
HPD Conjugated Antibody |
C38968 |
SAB |
100ul |
EUR 397 |
HPD Conjugated Antibody |
C43066 |
SAB |
100ul |
EUR 397 |
HPD cloning plasmid |
CSB-CL010698HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1182
- Sequence: atgacgacttacagtgacaaaggggcaaagcctgagagaggccgattcctccacttccactctgtgaccttctgggttggcaacgccaagcaggccgcgtcattctactgcagcaagatgggctttgaacctctagcctacaggggcctggagaccggttcccgggaggtggtca
- Show more
|
Description: A cloning plasmid for the HPD gene. |
Rat HPD(4-Hydroxyphenylpyruvate Dioxygenase) ELISA Kit