Rat RAB1A(RAB1A, Member RAS Oncogene Family) ELISA Kit

Rat RAB1A(RAB1A, Member RAS Oncogene Family) ELISA Kit

To Order Contact us: [email protected]

Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit

RD-RAB1A-Hu-96Tests 96 Tests
EUR 723

Rat RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit

  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit

SEJ783Ra-10x96wellstestplate 10x96-wells test plate
EUR 5124.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat RAB1A, Member RAS Oncogene Family (RAB1A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Ass
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat RAB1A, Member RAS Oncogene Family (RAB1A) in Tissue homogenates, cell lysates and other biological fluids.

Rat RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit

SEJ783Ra-1x48wellstestplate 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat RAB1A, Member RAS Oncogene Family (RAB1A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Ass
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat RAB1A, Member RAS Oncogene Family (RAB1A) in Tissue homogenates, cell lysates and other biological fluids.

Rat RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit

SEJ783Ra-1x96wellstestplate 1x96-wells test plate
EUR 685.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat RAB1A, Member RAS Oncogene Family (RAB1A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Ass
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat RAB1A, Member RAS Oncogene Family (RAB1A) in Tissue homogenates, cell lysates and other biological fluids.

Rat RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit

SEJ783Ra-5x96wellstestplate 5x96-wells test plate
EUR 2783.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat RAB1A, Member RAS Oncogene Family (RAB1A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Ass
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat RAB1A, Member RAS Oncogene Family (RAB1A) in Tissue homogenates, cell lysates and other biological fluids.

Rat RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit

  • EUR 5175.00
  • EUR 2734.00
  • EUR 686.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as RAB1A, Member RAS Oncogene Family elisa. Alternative names of the recognized antigen: RAB1
  • YPT1
  • Ras-related protein Rab-1A
  • YPT1-related protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat RAB1A, Member RAS Oncogene Family (RAB1A) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

RAB1A, Member RAS Oncogene Family (RAB1A) Antibody

abx218111-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

RAB1A, Member RAS Oncogene Family (RAB1A) Antibody

abx036061-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

RAB1A, Member RAS Oncogene Family (RAB1A) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

RAB1A, Member RAS Oncogene Family (RAB1A) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

RAB1A, Member RAS Oncogene Family (RAB1A) Antibody

abx237000-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Recombinant RAB1A, Member RAS Oncogene Family (RAB1A)

  • EUR 315.04
  • EUR 187.00
  • EUR 906.40
  • EUR 368.80
  • EUR 637.60
  • EUR 274.00
  • EUR 2116.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P62820
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 26.2kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human RAB1A, Member RAS Oncogene Family expressed in: E.coli

Rat RAB1A, Member RAS Oncogene Family (RAB1A) CLIA Kit

  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit

SEJ783Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB1A, Member RAS Oncogene Family (RAB1A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB1A, Member RAS Oncogene Family (RAB1A) in Tissue homogenates and other biological fluids.

Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit

SEJ783Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB1A, Member RAS Oncogene Family (RAB1A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB1A, Member RAS Oncogene Family (RAB1A) in Tissue homogenates and other biological fluids.

Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit

SEJ783Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB1A, Member RAS Oncogene Family (RAB1A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB1A, Member RAS Oncogene Family (RAB1A) in Tissue homogenates and other biological fluids.

Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit

SEJ783Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB1A, Member RAS Oncogene Family (RAB1A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB1A, Member RAS Oncogene Family (RAB1A) in Tissue homogenates and other biological fluids.

Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as RAB1A, Member RAS Oncogene Family elisa. Alternative names of the recognized antigen: RAB1
  • YPT1
  • Ras-related protein Rab-1A
  • YPT1-related protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human RAB1A, Member RAS Oncogene Family (RAB1A) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

ELISA kit for Rat RAB1A (RAB1A, Member RAS Oncogene Family)

ELK7514 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to RAB1A, Member RAS Oncogene Family (RAB1A). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody spec
  • Show more
Description: A sandwich ELISA kit for detection of RAB1A, Member RAS Oncogene Family from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

RAB1A, Member RAS Oncogene Family (RAB1A) Antibody Pair

abx117425-1pair5x96wellplates 1 pair (5x96 well plates)
EUR 1010
  • Shipped within 5-10 working days.

Human RAB1A, Member RAS Oncogene Family (RAB1A) Protein

  • EUR 453.00
  • EUR 230.00
  • EUR 1233.00
  • EUR 523.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human RAB1A, Member RAS Oncogene Family (RAB1A) CLIA Kit

  • EUR 7911.00
  • EUR 4215.00
  • EUR 973.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human RAB1A, Member RAS Oncogene Family (RAB1A)CLIA Kit

SCJ783Hu-10x96wellstestplate 10x96-wells test plate
EUR 5647.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB1A, Member RAS Oncogene Family (RAB1A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human RAB1A, Member RAS Oncogene Family (RAB1A) in Tissue homogenates and other biological fluids.

Human RAB1A, Member RAS Oncogene Family (RAB1A)CLIA Kit

SCJ783Hu-1x48wellstestplate 1x48-wells test plate
EUR 552.76
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB1A, Member RAS Oncogene Family (RAB1A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human RAB1A, Member RAS Oncogene Family (RAB1A) in Tissue homogenates and other biological fluids.

Human RAB1A, Member RAS Oncogene Family (RAB1A)CLIA Kit

SCJ783Hu-1x96wellstestplate 1x96-wells test plate
EUR 746.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB1A, Member RAS Oncogene Family (RAB1A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human RAB1A, Member RAS Oncogene Family (RAB1A) in Tissue homogenates and other biological fluids.

Human RAB1A, Member RAS Oncogene Family (RAB1A)CLIA Kit

SCJ783Hu-5x96wellstestplate 5x96-wells test plate
EUR 3060.6
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB1A, Member RAS Oncogene Family (RAB1A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human RAB1A, Member RAS Oncogene Family (RAB1A) in Tissue homogenates and other biological fluids.

Human RAB1A, Member RAS Oncogene Family (RAB1A) CLIA Kit

  • EUR 5698.00
  • EUR 3061.00
  • EUR 747.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as RAB1A, Member RAS Oncogene Family Clia kit. Alternative names of the recognized antigen: RAB1
  • YPT1
  • Ras-related protein Rab-1A
  • YPT1-related protein
Description: Double-antibody Sandwich chemiluminescent immunoassay for detection of Human RAB1A, Member RAS Oncogene Family (RAB1A)Tissue homogenates and other biological fluids

ELISA kit for Human RAB1A (RAB1A, Member RAS Oncogene Family)

ELK4405 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to RAB1A, Member RAS Oncogene Family (RAB1A). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody spec
  • Show more
Description: A sandwich ELISA kit for detection of RAB1A, Member RAS Oncogene Family from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

RAB1A, Member RAS Oncogene Family (RAB1A) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RAB1A (Ser2~Cys205)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human RAB1A, Member RAS Oncogene Family (RAB1A)

Rab1A, Member Ras Oncogene Family Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAB1A, Member RAS Oncogene Family Protein

  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

RAB1A, Member RAS Oncogene Family (RAB1A) Polyclonal Antibody (Human), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RAB1A (Ser2~Cys205)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human RAB1A, Member RAS Oncogene Family (RAB1A). This antibody is labeled with APC.

RAB1A, Member RAS Oncogene Family (RAB1A) Polyclonal Antibody (Human), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RAB1A (Ser2~Cys205)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human RAB1A, Member RAS Oncogene Family (RAB1A). This antibody is labeled with Biotin.

RAB1A, Member RAS Oncogene Family (RAB1A) Polyclonal Antibody (Human), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RAB1A (Ser2~Cys205)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human RAB1A, Member RAS Oncogene Family (RAB1A). This antibody is labeled with Cy3.

RAB1A, Member RAS Oncogene Family (RAB1A) Polyclonal Antibody (Human), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RAB1A (Ser2~Cys205)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human RAB1A, Member RAS Oncogene Family (RAB1A). This antibody is labeled with FITC.

RAB1A, Member RAS Oncogene Family (RAB1A) Polyclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RAB1A (Ser2~Cys205)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human RAB1A, Member RAS Oncogene Family (RAB1A). This antibody is labeled with HRP.

RAB1A, Member RAS Oncogene Family (RAB1A) Polyclonal Antibody (Human), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RAB1A (Ser2~Cys205)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human RAB1A, Member RAS Oncogene Family (RAB1A). This antibody is labeled with PE.

Recombinant Human RAB1A, Member RAS Oncogene Family

7-05971 2µg Ask for price

Recombinant Human RAB1A, Member RAS Oncogene Family

7-05972 10µg Ask for price

Recombinant Human RAB1A, Member RAS Oncogene Family

7-05973 1mg Ask for price

RAB1A, Member RAS Oncogene Family (RAB1A) Polyclonal Antibody (Human), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RAB1A (Ser2~Cys205)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human RAB1A, Member RAS Oncogene Family (RAB1A). This antibody is labeled with APC-Cy7.

RAB1A, Member RAS Oncogene Family Recombinant Protein Human

PROTP62820 Regular: 10ug
EUR 317
Description: RAB1A produced in E.Coli is a single, non-glycosylated polypeptide chain containing 225 amino acids (1-205.a.a) and having a molecular mass of 24.8kDa. ;RAB1A is fused to a 20 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Rab1A/ Rat Rab1A ELISA Kit

ELI-30459r 96 Tests
EUR 886

Rab1A ELISA Kit (Rat) (OKCD02017)

OKCD02017 96 Wells
EUR 896
Description: Description of target: The small GTPases Rab are key regulators of intracellular membrane trafficking, from the formation of transport vesicles to their fusion with membranes. Rabs cycle between an inactive GDP-bound form and an active GTP-bound form that is able to recruit to membranes different sets of downstream effectors directly responsible for vesicle formation, movement, tethering and fusion. RAB1A regulates vesicular protein transport from the endoplasmic reticulum (ER) to the Golgi compartment and on to the cell surface, and plays a role in IL-8 and growth hormone secretion. Regulates the level of CASR present at the cell membrane. Plays a role in cell adhesion and cell migration, via its role in protein trafficking. Plays a role in autophagosome assembly and cellular defense reactions against pathogenic bacteria. Plays a role in anterograde melanosome transport. Plays a role in microtubule-dependent protein transport by early endosomes.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.054 ng/mL

RAB1A antibody

70R-19689 50 ul
EUR 435
Description: Rabbit polyclonal RAB1A antibody

RAB1A antibody

70R-2860 50 ug
EUR 467
Description: Rabbit polyclonal RAB1A antibody raised against the middle region of RAB1A

Rab1A antibody

70R-15148 100 ug
EUR 327
Description: Rabbit polyclonal Rab1A antibody

RAB1A Antibody

39737-100ul 100ul
EUR 390

RAB1A Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB1A. Recognizes RAB1A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

RAB1A Antibody

DF9817 200ul
EUR 304
Description: RAB1A Antibody detects endogenous levels of total RAB1A.

RAB1A Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against RAB1A. Recognizes RAB1A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAB1A Antibody

ABD9817 100 ug
EUR 438


EF002218 96 Tests
EUR 689


ELI-36012d 96 Tests
EUR 928

ELISA kit for Rat Ras-related protein Rab-1A (RAB1A)

KTE100360-48T 48T
EUR 332
  • RAB1A encodes a member of the Ras superfamily of GTPases. Members of the gene family cycle between inactive GDP-bound and active GTP-bound forms. This small GTPase controls vesicle traffic from the endoplasmic reticulum to the Golgi apparatus. Multip
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Ras-related protein Rab-1A (RAB1A) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Ras-related protein Rab-1A (RAB1A)

KTE100360-5platesof96wells 5 plates of 96 wells
EUR 2115
  • RAB1A encodes a member of the Ras superfamily of GTPases. Members of the gene family cycle between inactive GDP-bound and active GTP-bound forms. This small GTPase controls vesicle traffic from the endoplasmic reticulum to the Golgi apparatus. Multip
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Ras-related protein Rab-1A (RAB1A) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Ras-related protein Rab-1A (RAB1A)

KTE100360-96T 96T
EUR 539
  • RAB1A encodes a member of the Ras superfamily of GTPases. Members of the gene family cycle between inactive GDP-bound and active GTP-bound forms. This small GTPase controls vesicle traffic from the endoplasmic reticulum to the Golgi apparatus. Multip
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Ras-related protein Rab-1A (RAB1A) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Porcine Ras- related protein Rab- 1A, RAB1A ELISA KIT

ELI-15084p 96 Tests
EUR 928

Mouse Ras- related protein Rab- 1A, Rab1A ELISA KIT

ELI-19603m 96 Tests
EUR 865

Human Ras- related protein Rab- 1A, RAB1A ELISA KIT

ELI-22148h 96 Tests
EUR 824

Rat RAB1A shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human Ras-related protein Rab-1A (RAB1A)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 49.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Ras-related protein Rab-1A(RAB1A) expressed in E.coli

Ras-Related Protein Rab-1A (RAB1A) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RAB1A ELISA Kit (Human) (OKCD00582)

OKCD00582 96 Wells
EUR 831
Description: Description of target: The small GTPases Rab are key regulators of intracellular membrane trafficking, from the formation of transport vesicles to their fusion with membranes. Rabs cycle between an inactive GDP-bound form and an active GTP-bound form that is able to recruit to membranes different sets of downstream effectors directly responsible for vesicle formation, movement, tethering and fusion. RAB1A regulates vesicular protein transport from the endoplasmic reticulum (ER) to the Golgi compartment and on to the cell surface, and plays a role in IL-8 and growth hormone secretion. Regulates the level of CASR present at the cell membrane. Plays a role in cell adhesion and cell migration, via its role in protein trafficking. Plays a role in autophagosome assembly and cellular defense reactions against pathogenic bacteria. Plays a role in microtubule-dependent protein transport by early endosomes and in anterograde melanosome transport.4 Publications <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.14"Rab1 small GTP-binding protein regulates cell surface trafficking of the human calcium-sensing receptor."_x005F_x005F_x000D_Zhuang X., Adipietro K.A., Datta S., Northup J.K., Ray K._x005F_x005F_x000D_Endocrinology 151:5114-5123(2010) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, MUTAGENESIS OF ASN-124.Ref.15"Regulation of integrin beta 1 recycling to lipid rafts by Rab1a to promote cell migration."_x005F_x005F_x000D_Wang C., Yoo Y., Fan H., Kim E., Guan K.L., Guan J.L._x005F_x005F_x000D_J. Biol. Chem. 285:29398-29405(2010) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION.Ref.17"Proteomic analysis of endocytic vesicles: Rab1a regulates motility of early endocytic vesicles."_x005F_x005F_x000D_Mukhopadhyay A., Nieves E., Che F.Y., Wang J., Jin L., Murray J.W., Gordon K., Angeletti R.H., Wolkoff A.W._x005F_x005F_x000D_J. Cell Sci. 124:765-775(2011) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, SUBCELLULAR LOCATION.Ref.27"Structurally distinct bacterial TBC-like GAPs link Arf GTPase to Rab1 inactivation to counteract host defenses."_x005F_x005F_x000D_Dong N., Zhu Y., Lu Q., Hu L., Zheng Y., Shao F._x005F_x005F_x000D_Cell 150:1029-1041(2012) [PubMed] [Europe PMC] [Abstract]Cited for: X-RAY CRYSTALLOGRAPHY (2.80 ANGSTROMS) OF 6-176 IN COMPLEXES WITH GDP; ARF6; E.COLI ESPG AND S.FLEXNERI VIRA, FUNCTION, SUBCELLULAR LOCATION, IDENTIFICATION IN A COMPLEX WITH ARF6 AND E.COLI ESPG, INTERACTION WITH E.COLI ESPG AND S.FLEXNERI VIRA. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.067 ng/mL

RAB1A ELISA Kit (Mouse) (OKCA01761)

OKCA01761 96 Wells
EUR 846
Description: Description of target: The small GTPases Rab are key regulators of intracellular membrane trafficking, from the formation of transport vesicles to their fusion with membranes. Rabs cycle between an inactive GDP-bound form and an active GTP-bound form that is able to recruit to membranes different sets of downstream effectors directly responsible for vesicle formation, movement, tethering and fusion. RAB1A regulates vesicular protein transport from the endoplasmic reticulum (ER) to the Golgi compartment and on to the cell surface, and plays a role in IL-8 and growth hormone secretion. Regulates the level of CASR present at the cell membrane. Plays a role in cell adhesion and cell migration, via its role in protein trafficking. Plays a role in autophagosome assembly and cellular defense reactions against pathogenic bacteria. Plays a role in microtubule-dependent protein transport by early endosomes and in anterograde melanosome transport.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 5.9 pg/mL

RAB1A ELISA Kit (Human) (OKDD00496)

OKDD00496 96 Wells
EUR 975
Description: Description of target: This gene encodes a member of the Ras superfamily of GTPases. Members of the gene family cycle between inactive GDP-bound and active GTP-bound forms. This small GTPase controls vesicle traffic from the endoplasmic reticulum to the Golgi apparatus. Multiple alternatively spliced transcript variants have been identified for this gene which encode different protein isoforms.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.067 ng/mL

RAB1A Polyclonal Antibody

28668-100ul 100ul
EUR 252

RAB1A Polyclonal Antibody

28668-50ul 50ul
EUR 187

RAB1A Polyclonal Antibody

30025-100ul 100ul
EUR 252

RAB1A Polyclonal Antibody

30025-50ul 50ul
EUR 187

RAB1A Rabbit pAb

A14663-100ul 100 ul
EUR 308

RAB1A Rabbit pAb

A14663-200ul 200 ul
EUR 459

RAB1A Rabbit pAb

A14663-20ul 20 ul
EUR 183

RAB1A Rabbit pAb

A14663-50ul 50 ul
EUR 223

RAB1A Blocking Peptide

33R-1303 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of UBE3A antibody, catalog no. 70R-5247

Rab1A antibody (HRP)

60R-1281 100 ug
EUR 327
Description: Rabbit polyclonal Rab1A antibody (HRP)

Rab1A antibody (FITC)

60R-1282 100 ug
EUR 327
Description: Rabbit polyclonal Rab1A antibody (FITC)

Rab1A antibody (biotin)

60R-1283 100 ug
EUR 327
Description: Rabbit polyclonal Rab1A antibody (biotin)

RAB1A Blocking Peptide

DF9817-BP 1mg
EUR 195

RAB1A cloning plasmid

CSB-CL019167HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 618
  • Sequence: atgtccagcatgaatcccgaatatgattatttattcaagttacttctgattggcgactcaggggttggaaagtcttgccttcttcttaggtttgcagatgatacatatacagaaagctacatcagcacaattggtgtggatttcaaaataagaactatagagttagacgggaaaac
  • Show more
Description: A cloning plasmid for the RAB1A gene.

RAB1A Polyclonal Antibody

A52624 100 µg
EUR 570.55
Description: The best epigenetics products

RAB1A Rabbit pAb

A17364-100ul 100 ul
EUR 308

RAB1A Rabbit pAb

A17364-200ul 200 ul
EUR 459

RAB1A Rabbit pAb

A17364-20ul 20 ul
EUR 183

RAB1A Rabbit pAb

A17364-50ul 50 ul
EUR 223

RAB1A Polyclonal Antibody

ABP60061-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human RAB1A protein at amino acid sequence of 50-130
  • Applications tips:
Description: A polyclonal antibody for detection of RAB1A from Human, Mouse, Rat. This RAB1A antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB1A protein at amino acid sequence of 50-130

RAB1A Polyclonal Antibody

ABP60061-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human RAB1A protein at amino acid sequence of 50-130
  • Applications tips:
Description: A polyclonal antibody for detection of RAB1A from Human, Mouse, Rat. This RAB1A antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB1A protein at amino acid sequence of 50-130

RAB1A Polyclonal Antibody

ABP60061-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human RAB1A protein at amino acid sequence of 50-130
  • Applications tips:
Description: A polyclonal antibody for detection of RAB1A from Human, Mouse, Rat. This RAB1A antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB1A protein at amino acid sequence of 50-130

anti- RAB1A antibody

FNab07000 100µg
EUR 505.25
  • Immunogen: RAB1A, member RAS oncogene family
  • Uniprot ID: P62820
  • Gene ID: 5861
  • Research Area: Signal Transduction
Description: Antibody raised against RAB1A

RAB1A Polyclonal Antibody

ES10115-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against RAB1A from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Rat RAB1A(RAB1A, Member RAS Oncogene Family) ELISA Kit