Human TMEM176B(Transmembrane Protein 176B) ELISA Kit

Human TMEM176B(Transmembrane Protein 176B) ELISA Kit

To Order Contact us: [email protected]

Human Transmembrane Protein 176B (TMEM176B) ELISA Kit
SEM863Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transmembrane Protein 176B (TMEM176B) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transmembrane Protein 176B (TMEM176B) in tissue homogenates, cell lysates and other biological fluids.

Human Transmembrane Protein 176B (TMEM176B) ELISA Kit
SEM863Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transmembrane Protein 176B (TMEM176B) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transmembrane Protein 176B (TMEM176B) in tissue homogenates, cell lysates and other biological fluids.

Human Transmembrane Protein 176B (TMEM176B) ELISA Kit
SEM863Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transmembrane Protein 176B (TMEM176B) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transmembrane Protein 176B (TMEM176B) in tissue homogenates, cell lysates and other biological fluids.

Human Transmembrane Protein 176B (TMEM176B) ELISA Kit
SEM863Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transmembrane Protein 176B (TMEM176B) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transmembrane Protein 176B (TMEM176B) in tissue homogenates, cell lysates and other biological fluids.

Human Transmembrane Protein 176B (TMEM176B) ELISA Kit
4-SEM863Hu
  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Transmembrane Protein 176B elisa. Alternative names of the recognized antigen: LR8
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Transmembrane Protein 176B (TMEM176B) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Transmembrane Protein 176B (TMEM176B) Antibody
abx238762-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Transmembrane Protein 176B (TMEM176B) Antibody
20-abx302903
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mouse Transmembrane protein 176B, Tmem176b ELISA KIT
ELI-13710m 96 Tests
EUR 865

Human Transmembrane Protein 176B (TMEM176B) CLIA Kit
20-abx496077
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human TMEM176B (Transmembrane Protein 176B)
ELK7461 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Transmembrane Protein 176B (TMEM176B). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific
  • Show more
Description: A sandwich ELISA kit for detection of Transmembrane Protein 176B from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Transmembrane Protein 176B (TMEM176B) Antibody (HRP)
20-abx305617
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Transmembrane Protein 176B (TMEM176B) Antibody (FITC)
20-abx305618
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Transmembrane Protein 176B (TMEM176B) Antibody (Biotin)
20-abx305619
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Transmembrane Protein 176B (THEM176B) Antibody
20-abx116243
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tmem176b/ Rat Tmem176b ELISA Kit
ELI-29945r 96 Tests
EUR 886

TMEM176B ELISA KIT|Human
EF003665 96 Tests
EUR 689

TMEM176B ELISA Kit (Human) (OKCD02076)
OKCD02076 96 Wells
EUR 909
Description: Description of target: May play a role in the process of maturation of dendritic cells. Required for the development of cerebellar granule cells.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.59 ng/mL

TMEM176B Recombinant Protein (Human)
RP032020 100 ug Ask for price

TMEM176B siRNA
20-abx905644
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TMEM176B siRNA
20-abx937161
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TMEM176B siRNA
20-abx937162
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TMEM176B antibody
70R-20872 50 ul
EUR 435
Description: Rabbit polyclonal TMEM176B antibody

TMEM176B antibody
70R-8537 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal TMEM176B antibody

TMEM176B Antibody
1-CSB-PA023758GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TMEM176B. Recognizes TMEM176B from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB

TMEM176B Antibody
1-CSB-PA023758LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TMEM176B. Recognizes TMEM176B from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202

TMEM176B Recombinant Protein (Rat)
RP233612 100 ug Ask for price

TMEM176B Recombinant Protein (Mouse)
RP179444 100 ug Ask for price

TMEM176B Recombinant Protein (Mouse)
RP179447 100 ug Ask for price

TMEM176B Recombinant Protein (Mouse)
RP179450 100 ug Ask for price

TMEM176B Recombinant Protein (Mouse)
RP179453 100 ug Ask for price

Human TMEM176B shRNA Plasmid
20-abx959128
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human Transmembrane protein 119 ELISA kit
E01T0877-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Transmembrane protein 119 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 119 ELISA kit
E01T0877-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Transmembrane protein 119 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 119 ELISA kit
E01T0877-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Transmembrane protein 119 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

TMEM176B cloning plasmid
CSB-CL023758HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 813
  • Sequence: atgacgcaaaacacggtgattgtgaatggagttgctatggcctctaggccatcccagcccacccacgtcaacgtccacatccaccaggagtcagctttgacacaactgctgaaagctggaggttctctgaagaagtttctttttcaccctggggacactgtgccttccacagccag
  • Show more
Description: A cloning plasmid for the TMEM176B gene.

anti- TMEM176B antibody
FNab08762 100µg
EUR 585
  • Recommended dilution: WB: 1:200-1:1000
  • IP: 1:500-1:1000
  • Immunogen: transmembrane protein 176B
  • Uniprot ID: Q3YBM2
  • Gene ID: 28959
  • Research Area: Signal Transduction, Metabolism, Developmental biology
Description: Antibody raised against TMEM176B

TMEM176B Polyclonal Antibody
A61382 100 µg
EUR 570.55
Description: The best epigenetics products

TMEM176B Rabbit pAb
A16118-100ul 100 ul
EUR 308

TMEM176B Rabbit pAb
A16118-200ul 200 ul
EUR 459

TMEM176B Rabbit pAb
A16118-20ul 20 ul
EUR 183

TMEM176B Rabbit pAb
A16118-50ul 50 ul
EUR 223

TMEM176B Blocking Peptide
33R-8633 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TMEM176B antibody, catalog no. 70R-8537

TMEM176B Polyclonal Antibody
29733-100ul 100ul
EUR 252

TMEM176B Polyclonal Antibody
29733-50ul 50ul
EUR 187

Anti-TMEM176B antibody
PAab08762 100 ug
EUR 412

Anti-TMEM176B antibody
STJ118571 100 µl
EUR 277

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

TMEM176B ORF Vector (Human) (pORF)
ORF010674 1.0 ug DNA
EUR 95

TMEM176B Protein Vector (Human) (pPB-C-His)
PV042693 500 ng
EUR 329

TMEM176B Protein Vector (Human) (pPB-N-His)
PV042694 500 ng
EUR 329

TMEM176B Protein Vector (Human) (pPM-C-HA)
PV042695 500 ng
EUR 329

TMEM176B Protein Vector (Human) (pPM-C-His)
PV042696 500 ng
EUR 329

Human Transmembrane protein 104(TMEM104) ELISA kit
E01T0699-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 104(TMEM104) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 104(TMEM104) ELISA kit
E01T0699-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 104(TMEM104) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 104(TMEM104) ELISA kit
E01T0699-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 104(TMEM104) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 121(TMEM121) ELISA kit
E01T0701-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 121(TMEM121) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 121(TMEM121) ELISA kit
E01T0701-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 121(TMEM121) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 121(TMEM121) ELISA kit
E01T0701-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 121(TMEM121) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 129(TMEM129) ELISA kit
E01T0702-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 129(TMEM129) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 129(TMEM129) ELISA kit
E01T0702-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 129(TMEM129) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 129(TMEM129) ELISA kit
E01T0702-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 129(TMEM129) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 170A(TMEM170A) ELISA kit
E01T0703-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 170A(TMEM170A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 170A(TMEM170A) ELISA kit
E01T0703-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 170A(TMEM170A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 170A(TMEM170A) ELISA kit
E01T0703-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 170A(TMEM170A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 173(TMEM173) ELISA kit
E01T0704-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 173(TMEM173) ELISA kit
E01T0704-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 173(TMEM173) ELISA kit
E01T0704-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 175(TMEM175) ELISA kit
E01T0705-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 175(TMEM175) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 175(TMEM175) ELISA kit
E01T0705-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 175(TMEM175) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 175(TMEM175) ELISA kit
E01T0705-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 175(TMEM175) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 18(TMEM18) ELISA kit
E01T0706-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 18(TMEM18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 18(TMEM18) ELISA kit
E01T0706-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 18(TMEM18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 18(TMEM18) ELISA kit
E01T0706-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 18(TMEM18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 180(TMEM180) ELISA kit
E01T0707-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 180(TMEM180) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 180(TMEM180) ELISA kit
E01T0707-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 180(TMEM180) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 180(TMEM180) ELISA kit
E01T0707-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 180(TMEM180) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 184C(TMEM184C) ELISA kit
E01T0708-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 184C(TMEM184C) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 184C(TMEM184C) ELISA kit
E01T0708-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 184C(TMEM184C) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 184C(TMEM184C) ELISA kit
E01T0708-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 184C(TMEM184C) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 194B(TMEM194B) ELISA kit
E01T0709-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 194B(TMEM194B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 194B(TMEM194B) ELISA kit
E01T0709-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 194B(TMEM194B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 194B(TMEM194B) ELISA kit
E01T0709-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 194B(TMEM194B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 208(TMEM208) ELISA kit
E01T0710-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 208(TMEM208) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 208(TMEM208) ELISA kit
E01T0710-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 208(TMEM208) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 208(TMEM208) ELISA kit
E01T0710-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 208(TMEM208) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 22(TMEM22) ELISA kit
E01T0711-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 22(TMEM22) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 22(TMEM22) ELISA kit
E01T0711-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 22(TMEM22) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 22(TMEM22) ELISA kit
E01T0711-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 22(TMEM22) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 41B(TMEM41B) ELISA kit
E01T0713-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 41B(TMEM41B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 41B(TMEM41B) ELISA kit
E01T0713-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 41B(TMEM41B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 41B(TMEM41B) ELISA kit
E01T0713-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 41B(TMEM41B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 68(TMEM68) ELISA kit
E01T0714-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 68(TMEM68) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 68(TMEM68) ELISA kit
E01T0714-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 68(TMEM68) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 68(TMEM68) ELISA kit
E01T0714-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 68(TMEM68) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human Transmembrane protein 158
EK2693 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Transmembrane protein 158 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Transmembrane protein 132D
EK4617 96 tests
EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Transmembrane protein 132D in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Transmembrane protein 126A
EK4626 96 tests
EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Transmembrane protein 126A in samples from serum, plasma, tissue homogenates and other biological fluids.

Human TMEM127(Transmembrane protein 127) ELISA Kit
EH4117 96T
EUR 524.1
  • Detection range: 78-5000 pg/ml
  • Uniprot ID: O75204
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml

Human TMEM126A/ Transmembrane protein 126A ELISA Kit
E2519Hu 1 Kit
EUR 605

Human TMEM132D/ Transmembrane protein 132D ELISA Kit
E2520Hu 1 Kit
EUR 605

Human TMEM158/ Transmembrane protein 158 ELISA Kit
E2521Hu 1 Kit
EUR 571

Human TMEM158(Transmembrane protein 158) ELISA Kit
EH1212 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q8WZ71
  • Alias: TMEM158/Transmembrane protein 158/40 kDa BINP-binding protein/p40BBP/Ras-induced senescence protein 1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human TMEM132D(Transmembrane protein 132D) ELISA Kit
EH2284 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q14C87
  • Alias: TMEM132D/Transmembrane protein 132D/Mature oligodendrocytes transmembrane protein(Mature OL transmembrane protein)
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human TMEM126A(Transmembrane protein 126A) ELISA Kit
EH2289 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q9H061
  • Alias: TMEM126A
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Transmembrane protein C20orf46, C20orf46 ELISA KIT
ELI-10133h 96 Tests
EUR 824

Human Transmembrane protein C9orf71, C9orf71 ELISA KIT
ELI-10273h 96 Tests
EUR 824

Human Transmembrane protein C9orf91, C9orf91 ELISA KIT
ELI-10653h 96 Tests
EUR 824

Human Transmembrane protein C9orf123, C9orf123 ELISA KIT
ELI-10970h 96 Tests
EUR 824

Human Transmembrane protein C9orf125, C9orf125 ELISA KIT
ELI-10971h 96 Tests
EUR 824

Human Transmembrane protein 106B, TMEM106B ELISA KIT
ELI-13690h 96 Tests
EUR 824

Human Transmembrane protein 183B, TMEM183B ELISA KIT
ELI-13712h 96 Tests
EUR 824

Human Transmembrane protein 229B, TMEM229B ELISA KIT
ELI-18570h 96 Tests
EUR 824

Human Transmembrane protein 132E, TMEM132E ELISA KIT
ELI-18753h 96 Tests
EUR 824

Human Transmembrane protein 150B, TMEM150B ELISA KIT
ELI-18754h 96 Tests
EUR 824

Human Transmembrane protein 194B, TMEM194B ELISA KIT
ELI-18755h 96 Tests
EUR 824

Human Transmembrane protein 104, TMEM104 ELISA KIT
ELI-22923h 96 Tests
EUR 824

Human Transmembrane protein 110, TMEM110 ELISA KIT
ELI-22925h 96 Tests
EUR 824

Human Transmembrane protein 143, TMEM143 ELISA KIT
ELI-22927h 96 Tests
EUR 824

Human Transmembrane protein 205, TMEM205 ELISA KIT
ELI-22933h 96 Tests
EUR 824

Human Transmembrane protein 39B, TMEM39B ELISA KIT
ELI-22937h 96 Tests
EUR 824

Human Transmembrane protein 26, TMEM26 ELISA KIT
ELI-22980h 96 Tests
EUR 824

Human Transmembrane protein 80, TMEM80 ELISA KIT
ELI-22984h 96 Tests
EUR 824

Human Transmembrane protein 132A, TMEM132A ELISA KIT
ELI-23553h 96 Tests
EUR 824

Human Transmembrane protein C2orf18, C2orf18 ELISA KIT
ELI-24968h 96 Tests
EUR 824

Human Transmembrane protein C1orf70, C1orf70 ELISA KIT
ELI-25022h 96 Tests
EUR 824

Human Transmembrane protein C9orf46, C9orf46 ELISA KIT
ELI-25290h 96 Tests
EUR 824

Human Transmembrane protein C9orf5, C9orf5 ELISA KIT
ELI-25647h 96 Tests
EUR 824

Human Transmembrane protein C10orf57, C10orf57 ELISA KIT
ELI-25797h 96 Tests
EUR 824

Human Transmembrane protein C7orf23, C7orf23 ELISA KIT
ELI-25903h 96 Tests
EUR 824

Human Transmembrane protein C18orf45, C18orf45 ELISA KIT
ELI-26110h 96 Tests
EUR 824

Human Transmembrane protein C16orf54, C16orf54 ELISA KIT
ELI-26166h 96 Tests
EUR 824

Human Transmembrane protein 158, TMEM158 ELISA KIT
ELI-03517h 96 Tests
EUR 824

Human Transmembrane protein 206, TMEM206 ELISA KIT
ELI-16076h 96 Tests
EUR 824

Human Transmembrane protein 213, TMEM213 ELISA KIT
ELI-16078h 96 Tests
EUR 824

Human Transmembrane protein 214, TMEM214 ELISA KIT
ELI-16079h 96 Tests
EUR 824

Human Transmembrane protein 235, TMEM235 ELISA KIT
ELI-16080h 96 Tests
EUR 824

Human Transmembrane protein 50B, TMEM50B ELISA KIT
ELI-16083h 96 Tests
EUR 824

Human Transmembrane protein 88B, TMEM88B ELISA KIT
ELI-16086h 96 Tests
EUR 824

Human Transmembrane protein 9, TMEM9 ELISA KIT
ELI-16307h 96 Tests
EUR 824

Human Transmembrane protein 25, TMEM25 ELISA KIT
ELI-16310h 96 Tests
EUR 824

Human Transmembrane protein 52, TMEM52 ELISA KIT
ELI-16312h 96 Tests
EUR 824

Human Transmembrane protein 60, TMEM60 ELISA KIT
ELI-16314h 96 Tests
EUR 824

Human Transmembrane protein 111, TMEM111 ELISA KIT
ELI-17099h 96 Tests
EUR 824

Human Transmembrane protein 139, TMEM139 ELISA KIT
ELI-17102h 96 Tests
EUR 824

Human Transmembrane protein 154, TMEM154 ELISA KIT
ELI-17104h 96 Tests
EUR 824

Human Transmembrane protein 204, TMEM204 ELISA KIT
ELI-17111h 96 Tests
EUR 824

Human Transmembrane protein 50A, TMEM50A ELISA KIT
ELI-17117h 96 Tests
EUR 824

Human Transmembrane protein 53, TMEM53 ELISA KIT
ELI-17124h 96 Tests
EUR 824

Human Transmembrane protein 72, TMEM72 ELISA KIT
ELI-17128h 96 Tests
EUR 824

Human Transmembrane protein 82, TMEM82 ELISA KIT
ELI-17130h 96 Tests
EUR 824

Human Transmembrane protein 92, TMEM92 ELISA KIT
ELI-17132h 96 Tests
EUR 824

Human Transmembrane protein 42, TMEM42 ELISA KIT
ELI-17216h 96 Tests
EUR 824

Human Transmembrane protein 68, TMEM68 ELISA KIT
ELI-17218h 96 Tests
EUR 824

Human Transmembrane protein 9B, TMEM9B ELISA KIT
ELI-17219h 96 Tests
EUR 824

Human Transmembrane protein 87A, TMEM87A ELISA KIT
ELI-17246h 96 Tests
EUR 824

Human Transmembrane protein 43, TMEM43 ELISA KIT
ELI-17261h 96 Tests
EUR 824

Human Transmembrane protein 71, TMEM71 ELISA KIT
ELI-17265h 96 Tests
EUR 824

Human Transmembrane protein 78, TMEM78 ELISA KIT
ELI-17266h 96 Tests
EUR 824

Human Transmembrane protein 97, TMEM97 ELISA KIT
ELI-17270h 96 Tests
EUR 824

Human Transmembrane protein 14D, TMEM14D ELISA KIT
ELI-17327h 96 Tests
EUR 824

Human Transmembrane protein 165, TMEM165 ELISA KIT
ELI-17328h 96 Tests
EUR 824

Human Transmembrane protein 171, TMEM171 ELISA KIT
ELI-17331h 96 Tests
EUR 824

Human Transmembrane protein 198, TMEM198 ELISA KIT
ELI-17334h 96 Tests
EUR 824

Human Transmembrane protein 199, TMEM199 ELISA KIT
ELI-17335h 96 Tests
EUR 824

Human Transmembrane protein 234, TMEM234 ELISA KIT
ELI-17340h 96 Tests
EUR 824

Human Transmembrane protein 136, TMEM136 ELISA KIT
ELI-17348h 96 Tests
EUR 824

Human Transmembrane protein 14A, TMEM14A ELISA KIT
ELI-17351h 96 Tests
EUR 824

Human Transmembrane protein 187, TMEM187 ELISA KIT
ELI-17356h 96 Tests
EUR 824

Human Transmembrane protein 220, TMEM220 ELISA KIT
ELI-17361h 96 Tests
EUR 824

Human Transmembrane protein 45B, TMEM45B ELISA KIT
ELI-17365h 96 Tests
EUR 824

Human Transmembrane protein C17orf87, C17orf87 ELISA KIT
ELI-09071h 96 Tests
EUR 824

Human Transmembrane protein 222, TMEM222 ELISA KIT
ELI-28228h 96 Tests
EUR 824

Human Transmembrane protein 41A, TMEM41A ELISA KIT
ELI-28229h 96 Tests
EUR 824

Human Transmembrane protein 63B, TMEM63B ELISA KIT
ELI-28232h 96 Tests
EUR 824

Human Transmembrane protein 19, TMEM19 ELISA KIT
ELI-51820h 96 Tests
EUR 824

Human Transmembrane protein 115, TMEM115 ELISA KIT
ELI-51903h 96 Tests
EUR 824

Human Transmembrane protein 125, TMEM125 ELISA KIT
ELI-51904h 96 Tests
EUR 824

Human Transmembrane protein 133, TMEM133 ELISA KIT
ELI-51905h 96 Tests
EUR 824

Human Transmembrane protein 209, TMEM209 ELISA KIT
ELI-51912h 96 Tests
EUR 824

Human Transmembrane protein 101, TMEM101 ELISA KIT
ELI-51997h 96 Tests
EUR 824

Human Transmembrane protein 138, TMEM138 ELISA KIT
ELI-52001h 96 Tests
EUR 824

Human Transmembrane protein 144, TMEM144 ELISA KIT
ELI-52002h 96 Tests
EUR 824

Human Transmembrane protein 14C, TMEM14C ELISA KIT
ELI-52004h 96 Tests
EUR 824

Human Transmembrane protein 173, TMEM173 ELISA KIT
ELI-52006h 96 Tests
EUR 824

Human Transmembrane protein 203, TMEM203 ELISA KIT
ELI-52008h 96 Tests
EUR 824

Human Transmembrane protein 218, TMEM218 ELISA KIT
ELI-52010h 96 Tests
EUR 824

Human Transmembrane protein 238, TMEM238 ELISA KIT
ELI-52014h 96 Tests
EUR 824

Human Transmembrane protein 63A, TMEM63A ELISA KIT
ELI-52016h 96 Tests
EUR 824

Human Transmembrane protein 132C, TMEM132C ELISA KIT
ELI-52143h 96 Tests
EUR 824

Human Transmembrane protein 132D, TMEM132D ELISA KIT
ELI-52144h 96 Tests
EUR 824

Human Transmembrane protein 151A, TMEM151A ELISA KIT
ELI-52148h 96 Tests
EUR 824

Human Transmembrane protein 179B, TMEM179B ELISA KIT
ELI-52149h 96 Tests
EUR 824

Human Transmembrane protein 183A, TMEM183A ELISA KIT
ELI-52150h 96 Tests
EUR 824

Human Transmembrane protein 184A, TMEM184A ELISA KIT
ELI-52151h 96 Tests
EUR 824

Human Transmembrane protein 184B, TMEM184B ELISA KIT
ELI-52152h 96 Tests
EUR 824

Human Transmembrane protein 229A, TMEM229A ELISA KIT
ELI-52157h 96 Tests
EUR 824

Human Transmembrane protein PVRIG, PVRIG ELISA KIT
ELI-52430h 96 Tests
EUR 824

Human Transmembrane protein 200C, TMEM200C ELISA KIT
ELI-53014h 96 Tests
EUR 824

Human Transmembrane protein 120B, TMEM120B ELISA KIT
ELI-53065h 96 Tests
EUR 824

Human Transmembrane protein 191C, TMEM191C ELISA KIT
ELI-53070h 96 Tests
EUR 824

Human Transmembrane protein C20orf108, C20orf108 ELISA KIT
ELI-32967h 96 Tests
EUR 824

Human Transmembrane protein C1orf162, C1orf162 ELISA KIT
ELI-33522h 96 Tests
EUR 824

Human Transmembrane protein C6orf70, C6orf70 ELISA KIT
ELI-34119h 96 Tests
EUR 824

Human Transmembrane protein 55A, TMEM55A ELISA KIT
ELI-36420h 96 Tests
EUR 824

Human Transmembrane protein 18, TMEM18 ELISA KIT
ELI-36428h 96 Tests
EUR 824

Human Transmembrane protein 56, TMEM56 ELISA KIT
ELI-36430h 96 Tests
EUR 824

Human Transmembrane protein 59, TMEM59 ELISA KIT
ELI-36431h 96 Tests
EUR 824

Human Transmembrane protein 88, TMEM88 ELISA KIT
ELI-36436h 96 Tests
EUR 824

Human Transmembrane protein 8A, TMEM8A ELISA KIT
ELI-36437h 96 Tests
EUR 824

Human Transmembrane protein 102, TMEM102 ELISA KIT
ELI-37518h 96 Tests
EUR 824

Human Transmembrane protein 119, TMEM119 ELISA KIT
ELI-37520h 96 Tests
EUR 824

Human Transmembrane protein 160, TMEM160 ELISA KIT
ELI-37524h 96 Tests
EUR 824

Human Transmembrane protein 178, TMEM178 ELISA KIT
ELI-37527h 96 Tests
EUR 824

Human Transmembrane protein 192, TMEM192 ELISA KIT
ELI-37529h 96 Tests
EUR 824

Human Transmembrane protein 201, TMEM201 ELISA KIT
ELI-37532h 96 Tests
EUR 824

Human Transmembrane protein 217, TMEM217 ELISA KIT
ELI-37538h 96 Tests
EUR 824

Human Transmembrane protein 219, TMEM219 ELISA KIT
ELI-37539h 96 Tests
EUR 824

Human Transmembrane protein 64, TMEM64 ELISA KIT
ELI-45519h 96 Tests
EUR 824

Human Transmembrane protein 91, TMEM91 ELISA KIT
ELI-45523h 96 Tests
EUR 824

Human Transmembrane protein 127, TMEM127 ELISA KIT
ELI-45939h 96 Tests
EUR 824

Human Transmembrane protein 169, TMEM169 ELISA KIT
ELI-45943h 96 Tests
EUR 824

Human Transmembrane protein 174, TMEM174 ELISA KIT
ELI-45944h 96 Tests
EUR 824

Human Transmembrane protein 208, TMEM208 ELISA KIT
ELI-45952h 96 Tests
EUR 824

Human Transmembrane protein 232, TMEM232 ELISA KIT
ELI-45954h 96 Tests
EUR 824

Human Transmembrane protein 239, TMEM239 ELISA KIT
ELI-45955h 96 Tests
EUR 824

Human Transmembrane protein 151B, TMEM151B ELISA KIT
ELI-46290h 96 Tests
EUR 824

Human Transmembrane protein 170A, TMEM170A ELISA KIT
ELI-46291h 96 Tests
EUR 824

Human Transmembrane protein 200A, TMEM200A ELISA KIT
ELI-46294h 96 Tests
EUR 824

Human Transmembrane protein FAM155A, FAM155A ELISA KIT
ELI-47459h 96 Tests
EUR 824

Human Transmembrane protein FAM155B, FAM155B ELISA KIT
ELI-47745h 96 Tests
EUR 824

Human Transmembrane protein 35, TMEM35 ELISA KIT
ELI-28246h 96 Tests
EUR 824

Human Transmembrane protein 44, TMEM44 ELISA KIT
ELI-28248h 96 Tests
EUR 824

Human Transmembrane protein 8C, TMEM8C ELISA KIT
ELI-28250h 96 Tests
EUR 824

Human Transmembrane protein 128, TMEM128 ELISA KIT
ELI-28887h 96 Tests
EUR 824

Human Transmembrane protein 14B, TMEM14B ELISA KIT
ELI-28892h 96 Tests
EUR 824

Human Transmembrane protein 156, TMEM156 ELISA KIT
ELI-28894h 96 Tests
EUR 824

Human Transmembrane protein 182, TMEM182 ELISA KIT
ELI-28897h 96 Tests
EUR 824

Human Transmembrane protein 189, TMEM189 ELISA KIT
ELI-28898h 96 Tests
EUR 824

Human Transmembrane protein 202, TMEM202 ELISA KIT
ELI-28901h 96 Tests
EUR 824

Human Transmembrane protein 207, TMEM207 ELISA KIT
ELI-28903h 96 Tests
EUR 824

Human Transmembrane protein 22, TMEM22 ELISA KIT
ELI-29086h 96 Tests
EUR 824

Human Transmembrane protein 54, TMEM54 ELISA KIT
ELI-29087h 96 Tests
EUR 824

Human Transmembrane protein 81, TMEM81 ELISA KIT
ELI-29089h 96 Tests
EUR 824

Human Transmembrane protein 89, TMEM89 ELISA KIT
ELI-29090h 96 Tests
EUR 824

Human Transmembrane protein 120A, TMEM120A ELISA KIT
ELI-29305h 96 Tests
EUR 824

Human Transmembrane protein 150C, TMEM150C ELISA KIT
ELI-29308h 96 Tests
EUR 824

Human Transmembrane protein 176A, TMEM176A ELISA KIT
ELI-29311h 96 Tests
EUR 824

Human Transmembrane protein 200B, TMEM200B ELISA KIT
ELI-29314h 96 Tests
EUR 824

Human Transmembrane protein 87B, TMEM87B ELISA KIT
ELI-29349h 96 Tests
EUR 824

Human Transmembrane protein 2, TMEM2 ELISA KIT
ELI-29361h 96 Tests
EUR 824

Human Transmembrane protein 31, TMEM31 ELISA KIT
ELI-29366h 96 Tests
EUR 824

Human Transmembrane protein 40, TMEM40 ELISA KIT
ELI-29368h 96 Tests
EUR 824

Human Transmembrane protein 107, TMEM107 ELISA KIT
ELI-29378h 96 Tests
EUR 824

Human Transmembrane protein 109, TMEM109 ELISA KIT
ELI-29379h 96 Tests
EUR 824

Human Transmembrane protein 147, TMEM147 ELISA KIT
ELI-29384h 96 Tests
EUR 824

Human Transmembrane protein 177, TMEM177 ELISA KIT
ELI-29386h 96 Tests
EUR 824

Human Transmembrane protein 190, TMEM190 ELISA KIT
ELI-29390h 96 Tests
EUR 824

Human Transmembrane protein 210, TMEM210 ELISA KIT
ELI-29391h 96 Tests
EUR 824

Human Transmembrane protein 212, TMEM212 ELISA KIT
ELI-29392h 96 Tests
EUR 824

Human Transmembrane protein 225, TMEM225 ELISA KIT
ELI-29395h 96 Tests
EUR 824

Human Transmembrane protein 63C, TMEM63C ELISA KIT
ELI-29400h 96 Tests
EUR 824

Human Transmembrane protein 65, TMEM65 ELISA KIT
ELI-29407h 96 Tests
EUR 824

Human Transmembrane protein 99, TMEM99 ELISA KIT
ELI-29409h 96 Tests
EUR 824

Human Transmembrane protein 126A, TMEM126A ELISA KIT
ELI-30002h 96 Tests
EUR 824

Human Transmembrane protein 132B, TMEM132B ELISA KIT
ELI-30003h 96 Tests
EUR 824

Human TMEM176B(Transmembrane Protein 176B) ELISA Kit