Human TMEM176B(Transmembrane Protein 176B) ELISA Kit
To Order Contact us: [email protected]
Human Transmembrane Protein 176B (TMEM176B) ELISA Kit |
SEM863Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5189.65 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transmembrane Protein 176B (TMEM176B) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transmembrane Protein 176B (TMEM176B) in tissue homogenates, cell lysates and other biological fluids. |
Human Transmembrane Protein 176B (TMEM176B) ELISA Kit |
SEM863Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 515.03 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transmembrane Protein 176B (TMEM176B) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transmembrane Protein 176B (TMEM176B) in tissue homogenates, cell lysates and other biological fluids. |
Human Transmembrane Protein 176B (TMEM176B) ELISA Kit |
SEM863Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 692.9 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transmembrane Protein 176B (TMEM176B) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transmembrane Protein 176B (TMEM176B) in tissue homogenates, cell lysates and other biological fluids. |
Human Transmembrane Protein 176B (TMEM176B) ELISA Kit |
SEM863Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2818.05 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transmembrane Protein 176B (TMEM176B) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transmembrane Protein 176B (TMEM176B) in tissue homogenates, cell lysates and other biological fluids. |
Human Transmembrane Protein 176B (TMEM176B) ELISA Kit |
4-SEM863Hu |
Cloud-Clone |
-
EUR 5240.00
-
EUR 2769.00
-
EUR 693.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Transmembrane Protein 176B elisa. Alternative names of the recognized antigen: LR8
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Transmembrane Protein 176B (TMEM176B) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Transmembrane Protein 176B (TMEM176B) Antibody |
abx238762-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
Transmembrane Protein 176B (TMEM176B) Antibody |
20-abx302903 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Mouse Transmembrane protein 176B, Tmem176b ELISA KIT |
ELI-13710m |
Lifescience Market |
96 Tests |
EUR 865 |
Human Transmembrane Protein 176B (TMEM176B) CLIA Kit |
20-abx496077 |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
ELISA kit for Human TMEM176B (Transmembrane Protein 176B) |
ELK7461 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Transmembrane Protein 176B (TMEM176B). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific
- Show more
|
Description: A sandwich ELISA kit for detection of Transmembrane Protein 176B from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Transmembrane Protein 176B (TMEM176B) Antibody (HRP) |
20-abx305617 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Transmembrane Protein 176B (TMEM176B) Antibody (FITC) |
20-abx305618 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Transmembrane Protein 176B (TMEM176B) Antibody (Biotin) |
20-abx305619 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Transmembrane Protein 176B (THEM176B) Antibody |
20-abx116243 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TMEM176B ELISA Kit (Human) (OKCD02076) |
OKCD02076 |
Aviva Systems Biology |
96 Wells |
EUR 909 |
Description: Description of target: May play a role in the process of maturation of dendritic cells. Required for the development of cerebellar granule cells.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.59 ng/mL |
TMEM176B Recombinant Protein (Human) |
RP032020 |
ABM |
100 ug |
Ask for price |
TMEM176B antibody |
70R-20872 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal TMEM176B antibody |
TMEM176B antibody |
70R-8537 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal TMEM176B antibody |
TMEM176B Antibody |
1-CSB-PA023758GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against TMEM176B. Recognizes TMEM176B from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
TMEM176B Antibody |
1-CSB-PA023758LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TMEM176B. Recognizes TMEM176B from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200 |
TMEM176B siRNA |
20-abx905644 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TMEM176B siRNA |
20-abx937161 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TMEM176B siRNA |
20-abx937162 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
TMEM176B Recombinant Protein (Rat) |
RP233612 |
ABM |
100 ug |
Ask for price |
TMEM176B Recombinant Protein (Mouse) |
RP179444 |
ABM |
100 ug |
Ask for price |
TMEM176B Recombinant Protein (Mouse) |
RP179447 |
ABM |
100 ug |
Ask for price |
TMEM176B Recombinant Protein (Mouse) |
RP179450 |
ABM |
100 ug |
Ask for price |
TMEM176B Recombinant Protein (Mouse) |
RP179453 |
ABM |
100 ug |
Ask for price |
Human TMEM176B shRNA Plasmid |
20-abx959128 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human Transmembrane protein 119 ELISA kit |
E01T0877-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Transmembrane protein 119 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 119 ELISA kit |
E01T0877-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Transmembrane protein 119 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 119 ELISA kit |
E01T0877-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Transmembrane protein 119 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
TMEM176B Polyclonal Antibody |
29733-100ul |
SAB |
100ul |
EUR 252 |
TMEM176B Polyclonal Antibody |
29733-50ul |
SAB |
50ul |
EUR 187 |
TMEM176B Rabbit pAb |
A16118-100ul |
Abclonal |
100 ul |
EUR 308 |
TMEM176B Rabbit pAb |
A16118-200ul |
Abclonal |
200 ul |
EUR 459 |
TMEM176B Rabbit pAb |
A16118-20ul |
Abclonal |
20 ul |
EUR 183 |
TMEM176B Rabbit pAb |
A16118-50ul |
Abclonal |
50 ul |
EUR 223 |
TMEM176B Blocking Peptide |
33R-8633 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TMEM176B antibody, catalog no. 70R-8537 |
TMEM176B cloning plasmid |
CSB-CL023758HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 813
- Sequence: atgacgcaaaacacggtgattgtgaatggagttgctatggcctctaggccatcccagcccacccacgtcaacgtccacatccaccaggagtcagctttgacacaactgctgaaagctggaggttctctgaagaagtttctttttcaccctggggacactgtgccttccacagccag
- Show more
|
Description: A cloning plasmid for the TMEM176B gene. |
TMEM176B Polyclonal Antibody |
A61382 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
anti- TMEM176B antibody |
FNab08762 |
FN Test |
100µg |
EUR 585 |
- Recommended dilution: WB: 1:200-1:1000
- IP: 1:500-1:1000
- Immunogen: transmembrane protein 176B
- Uniprot ID: Q3YBM2
- Gene ID: 28959
- Research Area: Signal Transduction, Metabolism, Developmental biology
|
Description: Antibody raised against TMEM176B |
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit |
CAS400A-KIT |
SBI |
1 kit (10 rxn) |
EUR 1110 |
|
TMEM176B ORF Vector (Human) (pORF) |
ORF010674 |
ABM |
1.0 ug DNA |
EUR 95 |
TMEM176B Protein Vector (Human) (pPB-C-His) |
PV042693 |
ABM |
500 ng |
EUR 329 |
TMEM176B Protein Vector (Human) (pPB-N-His) |
PV042694 |
ABM |
500 ng |
EUR 329 |
TMEM176B Protein Vector (Human) (pPM-C-HA) |
PV042695 |
ABM |
500 ng |
EUR 329 |
TMEM176B Protein Vector (Human) (pPM-C-His) |
PV042696 |
ABM |
500 ng |
EUR 329 |
Human Transmembrane Protein 27 (TMEM27)ELISA Kit |
201-12-2411 |
SunredBio |
96 tests |
EUR 440 |
- This Transmembrane Protein 27 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Transmembrane Protein 2 (TMEM2)ELISA Kit |
201-12-2413 |
SunredBio |
96 tests |
EUR 440 |
- This Transmembrane Protein 2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Transmembrane Protein 5 (TMEM5)ELISA Kit |
201-12-2414 |
SunredBio |
96 tests |
EUR 440 |
- This Transmembrane Protein 5 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Transmembrane Protein 1 (TMEM1)ELISA Kit |
201-12-2418 |
SunredBio |
96 tests |
EUR 440 |
- This Transmembrane Protein 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Transmembrane Protein 27 (TMEM27) ELISA Kit |
DLR-TMEM27-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Transmembrane Protein 27 (TMEM27) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Transmembrane Protein 27 (TMEM27) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Transmembrane Protein 27 (TMEM27) ELISA Kit |
DLR-TMEM27-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Transmembrane Protein 27 (TMEM27) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Transmembrane Protein 27 (TMEM27) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Transmembrane protein 119(TMEM119) ELISA kit |
CSB-EL023686HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Transmembrane protein 119 (TMEM119) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Transmembrane protein 119(TMEM119) ELISA kit |
1-CSB-EL023686HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Transmembrane protein 119(TMEM119) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Transmembrane protein 95(TMEM95) ELISA kit |
CSB-EL023899HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Transmembrane protein 95 (TMEM95) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Transmembrane protein 95(TMEM95) ELISA kit |
1-CSB-EL023899HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Transmembrane protein 95(TMEM95) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Transmembrane protein 104(TMEM104) ELISA kit |
E01T0699-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 104(TMEM104) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 104(TMEM104) ELISA kit |
E01T0699-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 104(TMEM104) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 104(TMEM104) ELISA kit |
E01T0699-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 104(TMEM104) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 121(TMEM121) ELISA kit |
E01T0701-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 121(TMEM121) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 121(TMEM121) ELISA kit |
E01T0701-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 121(TMEM121) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 121(TMEM121) ELISA kit |
E01T0701-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 121(TMEM121) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 129(TMEM129) ELISA kit |
E01T0702-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 129(TMEM129) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 129(TMEM129) ELISA kit |
E01T0702-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 129(TMEM129) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 129(TMEM129) ELISA kit |
E01T0702-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 129(TMEM129) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 170A(TMEM170A) ELISA kit |
E01T0703-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 170A(TMEM170A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 170A(TMEM170A) ELISA kit |
E01T0703-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 170A(TMEM170A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 170A(TMEM170A) ELISA kit |
E01T0703-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 170A(TMEM170A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 173(TMEM173) ELISA kit |
E01T0704-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 173(TMEM173) ELISA kit |
E01T0704-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 173(TMEM173) ELISA kit |
E01T0704-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 175(TMEM175) ELISA kit |
E01T0705-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 175(TMEM175) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 175(TMEM175) ELISA kit |
E01T0705-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 175(TMEM175) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 175(TMEM175) ELISA kit |
E01T0705-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 175(TMEM175) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 18(TMEM18) ELISA kit |
E01T0706-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 18(TMEM18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 18(TMEM18) ELISA kit |
E01T0706-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 18(TMEM18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 18(TMEM18) ELISA kit |
E01T0706-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 18(TMEM18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 180(TMEM180) ELISA kit |
E01T0707-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 180(TMEM180) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 180(TMEM180) ELISA kit |
E01T0707-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 180(TMEM180) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 180(TMEM180) ELISA kit |
E01T0707-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 180(TMEM180) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 184C(TMEM184C) ELISA kit |
E01T0708-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 184C(TMEM184C) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 184C(TMEM184C) ELISA kit |
E01T0708-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 184C(TMEM184C) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 184C(TMEM184C) ELISA kit |
E01T0708-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 184C(TMEM184C) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 194B(TMEM194B) ELISA kit |
E01T0709-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 194B(TMEM194B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 194B(TMEM194B) ELISA kit |
E01T0709-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 194B(TMEM194B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 194B(TMEM194B) ELISA kit |
E01T0709-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 194B(TMEM194B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 208(TMEM208) ELISA kit |
E01T0710-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 208(TMEM208) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 208(TMEM208) ELISA kit |
E01T0710-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 208(TMEM208) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 208(TMEM208) ELISA kit |
E01T0710-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 208(TMEM208) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 22(TMEM22) ELISA kit |
E01T0711-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 22(TMEM22) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 22(TMEM22) ELISA kit |
E01T0711-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 22(TMEM22) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 22(TMEM22) ELISA kit |
E01T0711-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 22(TMEM22) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 41B(TMEM41B) ELISA kit |
E01T0713-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 41B(TMEM41B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 41B(TMEM41B) ELISA kit |
E01T0713-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 41B(TMEM41B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 41B(TMEM41B) ELISA kit |
E01T0713-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 41B(TMEM41B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 68(TMEM68) ELISA kit |
E01T0714-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 68(TMEM68) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 68(TMEM68) ELISA kit |
E01T0714-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 68(TMEM68) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 68(TMEM68) ELISA kit |
E01T0714-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 68(TMEM68) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane Protein 27 (TMEM27) ELISA Kit |
20-abx153314 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Transmembrane Protein 127 (TMEM127) ELISA Kit |
abx257508-96tests |
Abbexa |
96 tests |
EUR 637 |
- Shipped within 5-12 working days.
|
Human Transmembrane Protein 173 (TMEM173) ELISA Kit |
20-abx258669 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Transmembrane Protein 158 (TMEM158) ELISA Kit |
abx250468-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Transmembrane Protein 132D (TMEM132D) ELISA Kit |
abx251634-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Transmembrane Protein 126A (TMEM126A) ELISA Kit |
abx251639-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human TMEM132D(Transmembrane protein 132D) ELISA Kit |
EH2284 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: Q14C87
- Alias: TMEM132D/Transmembrane protein 132D/Mature oligodendrocytes transmembrane protein(Mature OL transmembrane protein)
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
Human TMEM126A(Transmembrane protein 126A) ELISA Kit |
EH2289 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: Q9H061
- Alias: TMEM126A
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
Human TMEM127(Transmembrane protein 127) ELISA Kit |
EH4117 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 78-5000 pg/ml
- Uniprot ID: O75204
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml |
ELISA kit for Human Transmembrane protein 158 |
EK2693 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Transmembrane protein 158 in samples from serum, plasma, tissue homogenates and other biological fluids. |
ELISA kit for Human Transmembrane protein 132D |
EK4617 |
SAB |
96 tests |
EUR 603 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Transmembrane protein 132D in samples from serum, plasma, tissue homogenates and other biological fluids. |
ELISA kit for Human Transmembrane protein 126A |
EK4626 |
SAB |
96 tests |
EUR 603 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Transmembrane protein 126A in samples from serum, plasma, tissue homogenates and other biological fluids. |
Human TMEM126A/ Transmembrane protein 126A ELISA Kit |
E2519Hu |
Sunlong |
1 Kit |
EUR 605 |
Human TMEM132D/ Transmembrane protein 132D ELISA Kit |
E2520Hu |
Sunlong |
1 Kit |
EUR 605 |
Human TMEM158/ Transmembrane protein 158 ELISA Kit |
E2521Hu |
Sunlong |
1 Kit |
EUR 571 |
Human TMEM158(Transmembrane protein 158) ELISA Kit |
EH1212 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: Q8WZ71
- Alias: TMEM158/Transmembrane protein 158/40 kDa BINP-binding protein/p40BBP/Ras-induced senescence protein 1
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
Human Transmembrane protein 106B, TMEM106B ELISA KIT |
ELI-13690h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 183B, TMEM183B ELISA KIT |
ELI-13712h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 206, TMEM206 ELISA KIT |
ELI-16076h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 213, TMEM213 ELISA KIT |
ELI-16078h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 214, TMEM214 ELISA KIT |
ELI-16079h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 235, TMEM235 ELISA KIT |
ELI-16080h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 50B, TMEM50B ELISA KIT |
ELI-16083h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 88B, TMEM88B ELISA KIT |
ELI-16086h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 9, TMEM9 ELISA KIT |
ELI-16307h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 25, TMEM25 ELISA KIT |
ELI-16310h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 52, TMEM52 ELISA KIT |
ELI-16312h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 60, TMEM60 ELISA KIT |
ELI-16314h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 111, TMEM111 ELISA KIT |
ELI-17099h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 139, TMEM139 ELISA KIT |
ELI-17102h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 154, TMEM154 ELISA KIT |
ELI-17104h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 204, TMEM204 ELISA KIT |
ELI-17111h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 50A, TMEM50A ELISA KIT |
ELI-17117h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 53, TMEM53 ELISA KIT |
ELI-17124h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 72, TMEM72 ELISA KIT |
ELI-17128h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 82, TMEM82 ELISA KIT |
ELI-17130h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 92, TMEM92 ELISA KIT |
ELI-17132h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 42, TMEM42 ELISA KIT |
ELI-17216h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 68, TMEM68 ELISA KIT |
ELI-17218h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 9B, TMEM9B ELISA KIT |
ELI-17219h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 87A, TMEM87A ELISA KIT |
ELI-17246h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 43, TMEM43 ELISA KIT |
ELI-17261h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 71, TMEM71 ELISA KIT |
ELI-17265h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 78, TMEM78 ELISA KIT |
ELI-17266h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 97, TMEM97 ELISA KIT |
ELI-17270h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 14D, TMEM14D ELISA KIT |
ELI-17327h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 165, TMEM165 ELISA KIT |
ELI-17328h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 171, TMEM171 ELISA KIT |
ELI-17331h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 198, TMEM198 ELISA KIT |
ELI-17334h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 199, TMEM199 ELISA KIT |
ELI-17335h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 234, TMEM234 ELISA KIT |
ELI-17340h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 136, TMEM136 ELISA KIT |
ELI-17348h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 14A, TMEM14A ELISA KIT |
ELI-17351h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 187, TMEM187 ELISA KIT |
ELI-17356h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 220, TMEM220 ELISA KIT |
ELI-17361h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 45B, TMEM45B ELISA KIT |
ELI-17365h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein C17orf87, C17orf87 ELISA KIT |
ELI-09071h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein C20orf46, C20orf46 ELISA KIT |
ELI-10133h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein C9orf71, C9orf71 ELISA KIT |
ELI-10273h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein C9orf91, C9orf91 ELISA KIT |
ELI-10653h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein C9orf123, C9orf123 ELISA KIT |
ELI-10970h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein C9orf125, C9orf125 ELISA KIT |
ELI-10971h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 229B, TMEM229B ELISA KIT |
ELI-18570h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 132E, TMEM132E ELISA KIT |
ELI-18753h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 150B, TMEM150B ELISA KIT |
ELI-18754h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 194B, TMEM194B ELISA KIT |
ELI-18755h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 104, TMEM104 ELISA KIT |
ELI-22923h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 110, TMEM110 ELISA KIT |
ELI-22925h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 143, TMEM143 ELISA KIT |
ELI-22927h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 205, TMEM205 ELISA KIT |
ELI-22933h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 39B, TMEM39B ELISA KIT |
ELI-22937h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 26, TMEM26 ELISA KIT |
ELI-22980h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 80, TMEM80 ELISA KIT |
ELI-22984h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 132A, TMEM132A ELISA KIT |
ELI-23553h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein C2orf18, C2orf18 ELISA KIT |
ELI-24968h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein C1orf70, C1orf70 ELISA KIT |
ELI-25022h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein C9orf46, C9orf46 ELISA KIT |
ELI-25290h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein C9orf5, C9orf5 ELISA KIT |
ELI-25647h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 222, TMEM222 ELISA KIT |
ELI-28228h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 41A, TMEM41A ELISA KIT |
ELI-28229h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 63B, TMEM63B ELISA KIT |
ELI-28232h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 35, TMEM35 ELISA KIT |
ELI-28246h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 44, TMEM44 ELISA KIT |
ELI-28248h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 8C, TMEM8C ELISA KIT |
ELI-28250h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 128, TMEM128 ELISA KIT |
ELI-28887h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 14B, TMEM14B ELISA KIT |
ELI-28892h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 156, TMEM156 ELISA KIT |
ELI-28894h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 182, TMEM182 ELISA KIT |
ELI-28897h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 189, TMEM189 ELISA KIT |
ELI-28898h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 202, TMEM202 ELISA KIT |
ELI-28901h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 207, TMEM207 ELISA KIT |
ELI-28903h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 22, TMEM22 ELISA KIT |
ELI-29086h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 54, TMEM54 ELISA KIT |
ELI-29087h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 81, TMEM81 ELISA KIT |
ELI-29089h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 89, TMEM89 ELISA KIT |
ELI-29090h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 120A, TMEM120A ELISA KIT |
ELI-29305h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 150C, TMEM150C ELISA KIT |
ELI-29308h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 176A, TMEM176A ELISA KIT |
ELI-29311h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 200B, TMEM200B ELISA KIT |
ELI-29314h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 87B, TMEM87B ELISA KIT |
ELI-29349h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 2, TMEM2 ELISA KIT |
ELI-29361h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 31, TMEM31 ELISA KIT |
ELI-29366h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 40, TMEM40 ELISA KIT |
ELI-29368h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 107, TMEM107 ELISA KIT |
ELI-29378h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 109, TMEM109 ELISA KIT |
ELI-29379h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 147, TMEM147 ELISA KIT |
ELI-29384h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 177, TMEM177 ELISA KIT |
ELI-29386h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 190, TMEM190 ELISA KIT |
ELI-29390h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 210, TMEM210 ELISA KIT |
ELI-29391h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 212, TMEM212 ELISA KIT |
ELI-29392h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 225, TMEM225 ELISA KIT |
ELI-29395h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 63C, TMEM63C ELISA KIT |
ELI-29400h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 65, TMEM65 ELISA KIT |
ELI-29407h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 99, TMEM99 ELISA KIT |
ELI-29409h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 126A, TMEM126A ELISA KIT |
ELI-30002h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 132B, TMEM132B ELISA KIT |
ELI-30003h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 158, TMEM158 ELISA KIT |
ELI-03517h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein C10orf57, C10orf57 ELISA KIT |
ELI-25797h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein C7orf23, C7orf23 ELISA KIT |
ELI-25903h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein C18orf45, C18orf45 ELISA KIT |
ELI-26110h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein C16orf54, C16orf54 ELISA KIT |
ELI-26166h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 17, TMEM17 ELISA KIT |
ELI-51651h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 61, TMEM61 ELISA KIT |
ELI-51657h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 66, TMEM66 ELISA KIT |
ELI-51658h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 74, TMEM74 ELISA KIT |
ELI-51660h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 75, TMEM75 ELISA KIT |
ELI-51661h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 79, TMEM79 ELISA KIT |
ELI-51662h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 85, TMEM85 ELISA KIT |
ELI-51664h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 39A, TMEM39A ELISA KIT |
ELI-51676h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 108, TMEM108 ELISA KIT |
ELI-51741h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 117, TMEM117 ELISA KIT |
ELI-51743h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 129, TMEM129 ELISA KIT |
ELI-51747h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 135, TMEM135 ELISA KIT |
ELI-51748h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 146, TMEM146 ELISA KIT |
ELI-51750h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 14E, TMEM14E ELISA KIT |
ELI-51752h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 164, TMEM164 ELISA KIT |
ELI-51753h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 175, TMEM175 ELISA KIT |
ELI-51756h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 231, TMEM231 ELISA KIT |
ELI-51760h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 236, TMEM236 ELISA KIT |
ELI-51762h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 19, TMEM19 ELISA KIT |
ELI-51820h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 115, TMEM115 ELISA KIT |
ELI-51903h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 125, TMEM125 ELISA KIT |
ELI-51904h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 133, TMEM133 ELISA KIT |
ELI-51905h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 209, TMEM209 ELISA KIT |
ELI-51912h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 101, TMEM101 ELISA KIT |
ELI-51997h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 138, TMEM138 ELISA KIT |
ELI-52001h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 144, TMEM144 ELISA KIT |
ELI-52002h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 14C, TMEM14C ELISA KIT |
ELI-52004h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 173, TMEM173 ELISA KIT |
ELI-52006h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 203, TMEM203 ELISA KIT |
ELI-52008h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 218, TMEM218 ELISA KIT |
ELI-52010h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 238, TMEM238 ELISA KIT |
ELI-52014h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 63A, TMEM63A ELISA KIT |
ELI-52016h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 132C, TMEM132C ELISA KIT |
ELI-52143h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 132D, TMEM132D ELISA KIT |
ELI-52144h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 151A, TMEM151A ELISA KIT |
ELI-52148h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 179B, TMEM179B ELISA KIT |
ELI-52149h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 183A, TMEM183A ELISA KIT |
ELI-52150h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 184A, TMEM184A ELISA KIT |
ELI-52151h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 184B, TMEM184B ELISA KIT |
ELI-52152h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transmembrane protein 229A, TMEM229A ELISA KIT |
ELI-52157h |
Lifescience Market |
96 Tests |
EUR 824 |
Human TMEM176B(Transmembrane Protein 176B) ELISA Kit