Human TMEM176B(Transmembrane Protein 176B) ELISA Kit

Human TMEM176B(Transmembrane Protein 176B) ELISA Kit

To Order Contact us: [email protected]

Human Transmembrane Protein 176B (TMEM176B) ELISA Kit

SEM863Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transmembrane Protein 176B (TMEM176B) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transmembrane Protein 176B (TMEM176B) in tissue homogenates, cell lysates and other biological fluids.

Human Transmembrane Protein 176B (TMEM176B) ELISA Kit

SEM863Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transmembrane Protein 176B (TMEM176B) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transmembrane Protein 176B (TMEM176B) in tissue homogenates, cell lysates and other biological fluids.

Human Transmembrane Protein 176B (TMEM176B) ELISA Kit

SEM863Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transmembrane Protein 176B (TMEM176B) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transmembrane Protein 176B (TMEM176B) in tissue homogenates, cell lysates and other biological fluids.

Human Transmembrane Protein 176B (TMEM176B) ELISA Kit

SEM863Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transmembrane Protein 176B (TMEM176B) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transmembrane Protein 176B (TMEM176B) in tissue homogenates, cell lysates and other biological fluids.

Human Transmembrane Protein 176B (TMEM176B) ELISA Kit

  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Transmembrane Protein 176B elisa. Alternative names of the recognized antigen: LR8
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Transmembrane Protein 176B (TMEM176B) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Transmembrane Protein 176B (TMEM176B) Antibody

abx238762-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Transmembrane Protein 176B (TMEM176B) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mouse Transmembrane protein 176B, Tmem176b ELISA KIT

ELI-13710m 96 Tests
EUR 865

Human Transmembrane Protein 176B (TMEM176B) CLIA Kit

  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human TMEM176B (Transmembrane Protein 176B)

ELK7461 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Transmembrane Protein 176B (TMEM176B). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific
  • Show more
Description: A sandwich ELISA kit for detection of Transmembrane Protein 176B from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Transmembrane Protein 176B (TMEM176B) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Transmembrane Protein 176B (TMEM176B) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Transmembrane Protein 176B (TMEM176B) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Transmembrane Protein 176B (THEM176B) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tmem176b/ Rat Tmem176b ELISA Kit

ELI-29945r 96 Tests
EUR 886


EF003665 96 Tests
EUR 689

TMEM176B ELISA Kit (Human) (OKCD02076)

OKCD02076 96 Wells
EUR 909
Description: Description of target: May play a role in the process of maturation of dendritic cells. Required for the development of cerebellar granule cells.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.59 ng/mL

TMEM176B Recombinant Protein (Human)

RP032020 100 ug Ask for price

TMEM176B antibody

70R-20872 50 ul
EUR 435
Description: Rabbit polyclonal TMEM176B antibody

TMEM176B antibody

70R-8537 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal TMEM176B antibody

TMEM176B Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TMEM176B. Recognizes TMEM176B from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB

TMEM176B Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TMEM176B. Recognizes TMEM176B from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

TMEM176B Recombinant Protein (Rat)

RP233612 100 ug Ask for price

TMEM176B Recombinant Protein (Mouse)

RP179444 100 ug Ask for price

TMEM176B Recombinant Protein (Mouse)

RP179447 100 ug Ask for price

TMEM176B Recombinant Protein (Mouse)

RP179450 100 ug Ask for price

TMEM176B Recombinant Protein (Mouse)

RP179453 100 ug Ask for price

Human TMEM176B shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human Transmembrane protein 119 ELISA kit

E01T0877-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Transmembrane protein 119 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 119 ELISA kit

E01T0877-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Transmembrane protein 119 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 119 ELISA kit

E01T0877-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Transmembrane protein 119 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

TMEM176B Polyclonal Antibody

29733-100ul 100ul
EUR 252

TMEM176B Polyclonal Antibody

29733-50ul 50ul
EUR 187

TMEM176B Rabbit pAb

A16118-100ul 100 ul
EUR 308

TMEM176B Rabbit pAb

A16118-200ul 200 ul
EUR 459

TMEM176B Rabbit pAb

A16118-20ul 20 ul
EUR 183

TMEM176B Rabbit pAb

A16118-50ul 50 ul
EUR 223

TMEM176B Blocking Peptide

33R-8633 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TMEM176B antibody, catalog no. 70R-8537

TMEM176B cloning plasmid

CSB-CL023758HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 813
  • Sequence: atgacgcaaaacacggtgattgtgaatggagttgctatggcctctaggccatcccagcccacccacgtcaacgtccacatccaccaggagtcagctttgacacaactgctgaaagctggaggttctctgaagaagtttctttttcaccctggggacactgtgccttccacagccag
  • Show more
Description: A cloning plasmid for the TMEM176B gene.

TMEM176B Polyclonal Antibody

A61382 100 µg
EUR 570.55
Description: The best epigenetics products

anti- TMEM176B antibody

FNab08762 100µg
EUR 585
  • Recommended dilution: WB: 1:200-1:1000
  • IP: 1:500-1:1000
  • Immunogen: transmembrane protein 176B
  • Uniprot ID: Q3YBM2
  • Gene ID: 28959
  • Research Area: Signal Transduction, Metabolism, Developmental biology
Description: Antibody raised against TMEM176B

Anti-TMEM176B antibody

PAab08762 100 ug
EUR 412

Anti-TMEM176B antibody

STJ118571 100 µl
EUR 277

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

TMEM176B ORF Vector (Human) (pORF)

ORF010674 1.0 ug DNA
EUR 95

TMEM176B Protein Vector (Human) (pPB-C-His)

PV042693 500 ng
EUR 329

TMEM176B Protein Vector (Human) (pPB-N-His)

PV042694 500 ng
EUR 329

TMEM176B Protein Vector (Human) (pPM-C-HA)

PV042695 500 ng
EUR 329

TMEM176B Protein Vector (Human) (pPM-C-His)

PV042696 500 ng
EUR 329

Human Transmembrane Protein 27 (TMEM27)ELISA Kit

201-12-2411 96 tests
EUR 440
  • This Transmembrane Protein 27 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Transmembrane Protein 2 (TMEM2)ELISA Kit

201-12-2413 96 tests
EUR 440
  • This Transmembrane Protein 2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Transmembrane Protein 5 (TMEM5)ELISA Kit

201-12-2414 96 tests
EUR 440
  • This Transmembrane Protein 5 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Transmembrane Protein 1 (TMEM1)ELISA Kit

201-12-2418 96 tests
EUR 440
  • This Transmembrane Protein 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Transmembrane Protein 27 (TMEM27) ELISA Kit

DLR-TMEM27-Hu-48T 48T
EUR 517
  • Should the Human Transmembrane Protein 27 (TMEM27) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Transmembrane Protein 27 (TMEM27) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Transmembrane Protein 27 (TMEM27) ELISA Kit

DLR-TMEM27-Hu-96T 96T
EUR 673
  • Should the Human Transmembrane Protein 27 (TMEM27) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Transmembrane Protein 27 (TMEM27) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Transmembrane protein 119(TMEM119) ELISA kit

CSB-EL023686HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Transmembrane protein 119 (TMEM119) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Transmembrane protein 119(TMEM119) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Transmembrane protein 119(TMEM119) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Transmembrane protein 95(TMEM95) ELISA kit

CSB-EL023899HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Transmembrane protein 95 (TMEM95) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Transmembrane protein 95(TMEM95) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Transmembrane protein 95(TMEM95) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Transmembrane protein 104(TMEM104) ELISA kit

E01T0699-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 104(TMEM104) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 104(TMEM104) ELISA kit

E01T0699-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 104(TMEM104) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 104(TMEM104) ELISA kit

E01T0699-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 104(TMEM104) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 121(TMEM121) ELISA kit

E01T0701-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 121(TMEM121) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 121(TMEM121) ELISA kit

E01T0701-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 121(TMEM121) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 121(TMEM121) ELISA kit

E01T0701-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 121(TMEM121) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 129(TMEM129) ELISA kit

E01T0702-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 129(TMEM129) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 129(TMEM129) ELISA kit

E01T0702-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 129(TMEM129) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 129(TMEM129) ELISA kit

E01T0702-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 129(TMEM129) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 170A(TMEM170A) ELISA kit

E01T0703-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 170A(TMEM170A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 170A(TMEM170A) ELISA kit

E01T0703-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 170A(TMEM170A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 170A(TMEM170A) ELISA kit

E01T0703-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 170A(TMEM170A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 173(TMEM173) ELISA kit

E01T0704-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 173(TMEM173) ELISA kit

E01T0704-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 173(TMEM173) ELISA kit

E01T0704-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 173(TMEM173) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 175(TMEM175) ELISA kit

E01T0705-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 175(TMEM175) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 175(TMEM175) ELISA kit

E01T0705-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 175(TMEM175) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 175(TMEM175) ELISA kit

E01T0705-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 175(TMEM175) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 18(TMEM18) ELISA kit

E01T0706-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 18(TMEM18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 18(TMEM18) ELISA kit

E01T0706-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 18(TMEM18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 18(TMEM18) ELISA kit

E01T0706-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 18(TMEM18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 180(TMEM180) ELISA kit

E01T0707-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 180(TMEM180) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 180(TMEM180) ELISA kit

E01T0707-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 180(TMEM180) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 180(TMEM180) ELISA kit

E01T0707-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 180(TMEM180) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 184C(TMEM184C) ELISA kit

E01T0708-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 184C(TMEM184C) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 184C(TMEM184C) ELISA kit

E01T0708-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 184C(TMEM184C) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 184C(TMEM184C) ELISA kit

E01T0708-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 184C(TMEM184C) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 194B(TMEM194B) ELISA kit

E01T0709-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 194B(TMEM194B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 194B(TMEM194B) ELISA kit

E01T0709-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 194B(TMEM194B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 194B(TMEM194B) ELISA kit

E01T0709-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 194B(TMEM194B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 208(TMEM208) ELISA kit

E01T0710-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 208(TMEM208) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 208(TMEM208) ELISA kit

E01T0710-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 208(TMEM208) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 208(TMEM208) ELISA kit

E01T0710-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 208(TMEM208) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 22(TMEM22) ELISA kit

E01T0711-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 22(TMEM22) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 22(TMEM22) ELISA kit

E01T0711-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 22(TMEM22) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 22(TMEM22) ELISA kit

E01T0711-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 22(TMEM22) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 41B(TMEM41B) ELISA kit

E01T0713-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 41B(TMEM41B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 41B(TMEM41B) ELISA kit

E01T0713-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 41B(TMEM41B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 41B(TMEM41B) ELISA kit

E01T0713-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 41B(TMEM41B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 68(TMEM68) ELISA kit

E01T0714-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 68(TMEM68) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 68(TMEM68) ELISA kit

E01T0714-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 68(TMEM68) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 68(TMEM68) ELISA kit

E01T0714-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transmembrane protein 68(TMEM68) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane Protein 27 (TMEM27) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Transmembrane Protein 127 (TMEM127) ELISA Kit

abx257508-96tests 96 tests
EUR 637
  • Shipped within 5-12 working days.

Human Transmembrane Protein 173 (TMEM173) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Transmembrane Protein 158 (TMEM158) ELISA Kit

abx250468-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Transmembrane Protein 132D (TMEM132D) ELISA Kit

abx251634-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Transmembrane Protein 126A (TMEM126A) ELISA Kit

abx251639-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human TMEM132D(Transmembrane protein 132D) ELISA Kit

EH2284 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q14C87
  • Alias: TMEM132D/Transmembrane protein 132D/Mature oligodendrocytes transmembrane protein(Mature OL transmembrane protein)
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human TMEM126A(Transmembrane protein 126A) ELISA Kit

EH2289 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q9H061
  • Alias: TMEM126A
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human TMEM127(Transmembrane protein 127) ELISA Kit

EH4117 96T
EUR 524.1
  • Detection range: 78-5000 pg/ml
  • Uniprot ID: O75204
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml

ELISA kit for Human Transmembrane protein 158

EK2693 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Transmembrane protein 158 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Transmembrane protein 132D

EK4617 96 tests
EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Transmembrane protein 132D in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Transmembrane protein 126A

EK4626 96 tests
EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Transmembrane protein 126A in samples from serum, plasma, tissue homogenates and other biological fluids.

Human TMEM126A/ Transmembrane protein 126A ELISA Kit

E2519Hu 1 Kit
EUR 605

Human TMEM132D/ Transmembrane protein 132D ELISA Kit

E2520Hu 1 Kit
EUR 605

Human TMEM158/ Transmembrane protein 158 ELISA Kit

E2521Hu 1 Kit
EUR 571

Human TMEM158(Transmembrane protein 158) ELISA Kit

EH1212 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q8WZ71
  • Alias: TMEM158/Transmembrane protein 158/40 kDa BINP-binding protein/p40BBP/Ras-induced senescence protein 1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Transmembrane protein 106B, TMEM106B ELISA KIT

ELI-13690h 96 Tests
EUR 824

Human Transmembrane protein 183B, TMEM183B ELISA KIT

ELI-13712h 96 Tests
EUR 824

Human Transmembrane protein 206, TMEM206 ELISA KIT

ELI-16076h 96 Tests
EUR 824

Human Transmembrane protein 213, TMEM213 ELISA KIT

ELI-16078h 96 Tests
EUR 824

Human Transmembrane protein 214, TMEM214 ELISA KIT

ELI-16079h 96 Tests
EUR 824

Human Transmembrane protein 235, TMEM235 ELISA KIT

ELI-16080h 96 Tests
EUR 824

Human Transmembrane protein 50B, TMEM50B ELISA KIT

ELI-16083h 96 Tests
EUR 824

Human Transmembrane protein 88B, TMEM88B ELISA KIT

ELI-16086h 96 Tests
EUR 824

Human Transmembrane protein 9, TMEM9 ELISA KIT

ELI-16307h 96 Tests
EUR 824

Human Transmembrane protein 25, TMEM25 ELISA KIT

ELI-16310h 96 Tests
EUR 824

Human Transmembrane protein 52, TMEM52 ELISA KIT

ELI-16312h 96 Tests
EUR 824

Human Transmembrane protein 60, TMEM60 ELISA KIT

ELI-16314h 96 Tests
EUR 824

Human Transmembrane protein 111, TMEM111 ELISA KIT

ELI-17099h 96 Tests
EUR 824

Human Transmembrane protein 139, TMEM139 ELISA KIT

ELI-17102h 96 Tests
EUR 824

Human Transmembrane protein 154, TMEM154 ELISA KIT

ELI-17104h 96 Tests
EUR 824

Human Transmembrane protein 204, TMEM204 ELISA KIT

ELI-17111h 96 Tests
EUR 824

Human Transmembrane protein 50A, TMEM50A ELISA KIT

ELI-17117h 96 Tests
EUR 824

Human Transmembrane protein 53, TMEM53 ELISA KIT

ELI-17124h 96 Tests
EUR 824

Human Transmembrane protein 72, TMEM72 ELISA KIT

ELI-17128h 96 Tests
EUR 824

Human Transmembrane protein 82, TMEM82 ELISA KIT

ELI-17130h 96 Tests
EUR 824

Human Transmembrane protein 92, TMEM92 ELISA KIT

ELI-17132h 96 Tests
EUR 824

Human Transmembrane protein 42, TMEM42 ELISA KIT

ELI-17216h 96 Tests
EUR 824

Human Transmembrane protein 68, TMEM68 ELISA KIT

ELI-17218h 96 Tests
EUR 824

Human Transmembrane protein 9B, TMEM9B ELISA KIT

ELI-17219h 96 Tests
EUR 824

Human Transmembrane protein 87A, TMEM87A ELISA KIT

ELI-17246h 96 Tests
EUR 824

Human Transmembrane protein 43, TMEM43 ELISA KIT

ELI-17261h 96 Tests
EUR 824

Human Transmembrane protein 71, TMEM71 ELISA KIT

ELI-17265h 96 Tests
EUR 824

Human Transmembrane protein 78, TMEM78 ELISA KIT

ELI-17266h 96 Tests
EUR 824

Human Transmembrane protein 97, TMEM97 ELISA KIT

ELI-17270h 96 Tests
EUR 824

Human Transmembrane protein 14D, TMEM14D ELISA KIT

ELI-17327h 96 Tests
EUR 824

Human Transmembrane protein 165, TMEM165 ELISA KIT

ELI-17328h 96 Tests
EUR 824

Human Transmembrane protein 171, TMEM171 ELISA KIT

ELI-17331h 96 Tests
EUR 824

Human Transmembrane protein 198, TMEM198 ELISA KIT

ELI-17334h 96 Tests
EUR 824

Human Transmembrane protein 199, TMEM199 ELISA KIT

ELI-17335h 96 Tests
EUR 824

Human Transmembrane protein 234, TMEM234 ELISA KIT

ELI-17340h 96 Tests
EUR 824

Human Transmembrane protein 136, TMEM136 ELISA KIT

ELI-17348h 96 Tests
EUR 824

Human Transmembrane protein 14A, TMEM14A ELISA KIT

ELI-17351h 96 Tests
EUR 824

Human Transmembrane protein 187, TMEM187 ELISA KIT

ELI-17356h 96 Tests
EUR 824

Human Transmembrane protein 220, TMEM220 ELISA KIT

ELI-17361h 96 Tests
EUR 824

Human Transmembrane protein 45B, TMEM45B ELISA KIT

ELI-17365h 96 Tests
EUR 824

Human Transmembrane protein C17orf87, C17orf87 ELISA KIT

ELI-09071h 96 Tests
EUR 824

Human Transmembrane protein C20orf46, C20orf46 ELISA KIT

ELI-10133h 96 Tests
EUR 824

Human Transmembrane protein C9orf71, C9orf71 ELISA KIT

ELI-10273h 96 Tests
EUR 824

Human Transmembrane protein C9orf91, C9orf91 ELISA KIT

ELI-10653h 96 Tests
EUR 824

Human Transmembrane protein C9orf123, C9orf123 ELISA KIT

ELI-10970h 96 Tests
EUR 824

Human Transmembrane protein C9orf125, C9orf125 ELISA KIT

ELI-10971h 96 Tests
EUR 824

Human Transmembrane protein 229B, TMEM229B ELISA KIT

ELI-18570h 96 Tests
EUR 824

Human Transmembrane protein 132E, TMEM132E ELISA KIT

ELI-18753h 96 Tests
EUR 824

Human Transmembrane protein 150B, TMEM150B ELISA KIT

ELI-18754h 96 Tests
EUR 824

Human Transmembrane protein 194B, TMEM194B ELISA KIT

ELI-18755h 96 Tests
EUR 824

Human Transmembrane protein 104, TMEM104 ELISA KIT

ELI-22923h 96 Tests
EUR 824

Human Transmembrane protein 110, TMEM110 ELISA KIT

ELI-22925h 96 Tests
EUR 824

Human Transmembrane protein 143, TMEM143 ELISA KIT

ELI-22927h 96 Tests
EUR 824

Human Transmembrane protein 205, TMEM205 ELISA KIT

ELI-22933h 96 Tests
EUR 824

Human Transmembrane protein 39B, TMEM39B ELISA KIT

ELI-22937h 96 Tests
EUR 824

Human Transmembrane protein 26, TMEM26 ELISA KIT

ELI-22980h 96 Tests
EUR 824

Human Transmembrane protein 80, TMEM80 ELISA KIT

ELI-22984h 96 Tests
EUR 824

Human Transmembrane protein 132A, TMEM132A ELISA KIT

ELI-23553h 96 Tests
EUR 824

Human Transmembrane protein C2orf18, C2orf18 ELISA KIT

ELI-24968h 96 Tests
EUR 824

Human Transmembrane protein C1orf70, C1orf70 ELISA KIT

ELI-25022h 96 Tests
EUR 824

Human Transmembrane protein C9orf46, C9orf46 ELISA KIT

ELI-25290h 96 Tests
EUR 824

Human Transmembrane protein C9orf5, C9orf5 ELISA KIT

ELI-25647h 96 Tests
EUR 824

Human Transmembrane protein 222, TMEM222 ELISA KIT

ELI-28228h 96 Tests
EUR 824

Human Transmembrane protein 41A, TMEM41A ELISA KIT

ELI-28229h 96 Tests
EUR 824

Human Transmembrane protein 63B, TMEM63B ELISA KIT

ELI-28232h 96 Tests
EUR 824

Human Transmembrane protein 35, TMEM35 ELISA KIT

ELI-28246h 96 Tests
EUR 824

Human Transmembrane protein 44, TMEM44 ELISA KIT

ELI-28248h 96 Tests
EUR 824

Human Transmembrane protein 8C, TMEM8C ELISA KIT

ELI-28250h 96 Tests
EUR 824

Human Transmembrane protein 128, TMEM128 ELISA KIT

ELI-28887h 96 Tests
EUR 824

Human Transmembrane protein 14B, TMEM14B ELISA KIT

ELI-28892h 96 Tests
EUR 824

Human Transmembrane protein 156, TMEM156 ELISA KIT

ELI-28894h 96 Tests
EUR 824

Human Transmembrane protein 182, TMEM182 ELISA KIT

ELI-28897h 96 Tests
EUR 824

Human Transmembrane protein 189, TMEM189 ELISA KIT

ELI-28898h 96 Tests
EUR 824

Human Transmembrane protein 202, TMEM202 ELISA KIT

ELI-28901h 96 Tests
EUR 824

Human Transmembrane protein 207, TMEM207 ELISA KIT

ELI-28903h 96 Tests
EUR 824

Human Transmembrane protein 22, TMEM22 ELISA KIT

ELI-29086h 96 Tests
EUR 824

Human Transmembrane protein 54, TMEM54 ELISA KIT

ELI-29087h 96 Tests
EUR 824

Human Transmembrane protein 81, TMEM81 ELISA KIT

ELI-29089h 96 Tests
EUR 824

Human Transmembrane protein 89, TMEM89 ELISA KIT

ELI-29090h 96 Tests
EUR 824

Human Transmembrane protein 120A, TMEM120A ELISA KIT

ELI-29305h 96 Tests
EUR 824

Human Transmembrane protein 150C, TMEM150C ELISA KIT

ELI-29308h 96 Tests
EUR 824

Human Transmembrane protein 176A, TMEM176A ELISA KIT

ELI-29311h 96 Tests
EUR 824

Human Transmembrane protein 200B, TMEM200B ELISA KIT

ELI-29314h 96 Tests
EUR 824

Human Transmembrane protein 87B, TMEM87B ELISA KIT

ELI-29349h 96 Tests
EUR 824

Human Transmembrane protein 2, TMEM2 ELISA KIT

ELI-29361h 96 Tests
EUR 824

Human Transmembrane protein 31, TMEM31 ELISA KIT

ELI-29366h 96 Tests
EUR 824

Human Transmembrane protein 40, TMEM40 ELISA KIT

ELI-29368h 96 Tests
EUR 824

Human Transmembrane protein 107, TMEM107 ELISA KIT

ELI-29378h 96 Tests
EUR 824

Human Transmembrane protein 109, TMEM109 ELISA KIT

ELI-29379h 96 Tests
EUR 824

Human Transmembrane protein 147, TMEM147 ELISA KIT

ELI-29384h 96 Tests
EUR 824

Human Transmembrane protein 177, TMEM177 ELISA KIT

ELI-29386h 96 Tests
EUR 824

Human Transmembrane protein 190, TMEM190 ELISA KIT

ELI-29390h 96 Tests
EUR 824

Human Transmembrane protein 210, TMEM210 ELISA KIT

ELI-29391h 96 Tests
EUR 824

Human Transmembrane protein 212, TMEM212 ELISA KIT

ELI-29392h 96 Tests
EUR 824

Human Transmembrane protein 225, TMEM225 ELISA KIT

ELI-29395h 96 Tests
EUR 824

Human Transmembrane protein 63C, TMEM63C ELISA KIT

ELI-29400h 96 Tests
EUR 824

Human Transmembrane protein 65, TMEM65 ELISA KIT

ELI-29407h 96 Tests
EUR 824

Human Transmembrane protein 99, TMEM99 ELISA KIT

ELI-29409h 96 Tests
EUR 824

Human Transmembrane protein 126A, TMEM126A ELISA KIT

ELI-30002h 96 Tests
EUR 824

Human Transmembrane protein 132B, TMEM132B ELISA KIT

ELI-30003h 96 Tests
EUR 824

Human Transmembrane protein 158, TMEM158 ELISA KIT

ELI-03517h 96 Tests
EUR 824

Human Transmembrane protein C10orf57, C10orf57 ELISA KIT

ELI-25797h 96 Tests
EUR 824

Human Transmembrane protein C7orf23, C7orf23 ELISA KIT

ELI-25903h 96 Tests
EUR 824

Human Transmembrane protein C18orf45, C18orf45 ELISA KIT

ELI-26110h 96 Tests
EUR 824

Human Transmembrane protein C16orf54, C16orf54 ELISA KIT

ELI-26166h 96 Tests
EUR 824

Human Transmembrane protein 17, TMEM17 ELISA KIT

ELI-51651h 96 Tests
EUR 824

Human Transmembrane protein 61, TMEM61 ELISA KIT

ELI-51657h 96 Tests
EUR 824

Human Transmembrane protein 66, TMEM66 ELISA KIT

ELI-51658h 96 Tests
EUR 824

Human Transmembrane protein 74, TMEM74 ELISA KIT

ELI-51660h 96 Tests
EUR 824

Human Transmembrane protein 75, TMEM75 ELISA KIT

ELI-51661h 96 Tests
EUR 824

Human Transmembrane protein 79, TMEM79 ELISA KIT

ELI-51662h 96 Tests
EUR 824

Human Transmembrane protein 85, TMEM85 ELISA KIT

ELI-51664h 96 Tests
EUR 824

Human Transmembrane protein 39A, TMEM39A ELISA KIT

ELI-51676h 96 Tests
EUR 824

Human Transmembrane protein 108, TMEM108 ELISA KIT

ELI-51741h 96 Tests
EUR 824

Human Transmembrane protein 117, TMEM117 ELISA KIT

ELI-51743h 96 Tests
EUR 824

Human Transmembrane protein 129, TMEM129 ELISA KIT

ELI-51747h 96 Tests
EUR 824

Human Transmembrane protein 135, TMEM135 ELISA KIT

ELI-51748h 96 Tests
EUR 824

Human Transmembrane protein 146, TMEM146 ELISA KIT

ELI-51750h 96 Tests
EUR 824

Human Transmembrane protein 14E, TMEM14E ELISA KIT

ELI-51752h 96 Tests
EUR 824

Human Transmembrane protein 164, TMEM164 ELISA KIT

ELI-51753h 96 Tests
EUR 824

Human Transmembrane protein 175, TMEM175 ELISA KIT

ELI-51756h 96 Tests
EUR 824

Human Transmembrane protein 231, TMEM231 ELISA KIT

ELI-51760h 96 Tests
EUR 824

Human Transmembrane protein 236, TMEM236 ELISA KIT

ELI-51762h 96 Tests
EUR 824

Human Transmembrane protein 19, TMEM19 ELISA KIT

ELI-51820h 96 Tests
EUR 824

Human Transmembrane protein 115, TMEM115 ELISA KIT

ELI-51903h 96 Tests
EUR 824

Human Transmembrane protein 125, TMEM125 ELISA KIT

ELI-51904h 96 Tests
EUR 824

Human Transmembrane protein 133, TMEM133 ELISA KIT

ELI-51905h 96 Tests
EUR 824

Human Transmembrane protein 209, TMEM209 ELISA KIT

ELI-51912h 96 Tests
EUR 824

Human Transmembrane protein 101, TMEM101 ELISA KIT

ELI-51997h 96 Tests
EUR 824

Human Transmembrane protein 138, TMEM138 ELISA KIT

ELI-52001h 96 Tests
EUR 824

Human Transmembrane protein 144, TMEM144 ELISA KIT

ELI-52002h 96 Tests
EUR 824

Human Transmembrane protein 14C, TMEM14C ELISA KIT

ELI-52004h 96 Tests
EUR 824

Human Transmembrane protein 173, TMEM173 ELISA KIT

ELI-52006h 96 Tests
EUR 824

Human Transmembrane protein 203, TMEM203 ELISA KIT

ELI-52008h 96 Tests
EUR 824

Human Transmembrane protein 218, TMEM218 ELISA KIT

ELI-52010h 96 Tests
EUR 824

Human Transmembrane protein 238, TMEM238 ELISA KIT

ELI-52014h 96 Tests
EUR 824

Human Transmembrane protein 63A, TMEM63A ELISA KIT

ELI-52016h 96 Tests
EUR 824

Human Transmembrane protein 132C, TMEM132C ELISA KIT

ELI-52143h 96 Tests
EUR 824

Human Transmembrane protein 132D, TMEM132D ELISA KIT

ELI-52144h 96 Tests
EUR 824

Human Transmembrane protein 151A, TMEM151A ELISA KIT

ELI-52148h 96 Tests
EUR 824

Human Transmembrane protein 179B, TMEM179B ELISA KIT

ELI-52149h 96 Tests
EUR 824

Human Transmembrane protein 183A, TMEM183A ELISA KIT

ELI-52150h 96 Tests
EUR 824

Human Transmembrane protein 184A, TMEM184A ELISA KIT

ELI-52151h 96 Tests
EUR 824

Human Transmembrane protein 184B, TMEM184B ELISA KIT

ELI-52152h 96 Tests
EUR 824

Human Transmembrane protein 229A, TMEM229A ELISA KIT

ELI-52157h 96 Tests
EUR 824

Human TMEM176B(Transmembrane Protein 176B) ELISA Kit