Human RAB5C(RAB5C, Member RAS Oncogene Family) ELISA Kit

Human RAB5C(RAB5C, Member RAS Oncogene Family) ELISA Kit

To Order Contact us: [email protected]

Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit
RDR-RAB5C-Hu-96Tests 96 Tests
EUR 820
RAB5C, Member RAS Oncogene Family (RAB5C) Antibody
20-abx119126
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.
RAB5C, Member RAS Oncogene Family (RAB5C) Antibody
20-abx133436
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
RAB5C, Member RAS Oncogene Family (RAB5C) Antibody
20-abx006922
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
RAB5C, Member RAS Oncogene Family (RAB5C) Antibody
20-abx320910
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
RAB5C, Member RAS Oncogene Family (RAB5C) Antibody
20-abx320911
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
RAB5C, Member RAS Oncogene Family (RAB5C) Antibody
20-abx329139
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
RAB5C, Member RAS Oncogene Family (RAB5C) Antibody
abx216507-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.
RAB5C, Member RAS Oncogene Family (RAB5C) Antibody
20-abx212323
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
RAB5C, Member RAS Oncogene Family (RAB5C) Antibody
20-abx213565
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit
20-abx258183
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit
SEP757Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB5C, Member RAS Oncogene Family (RAB5C) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB5C, Member RAS Oncogene Family (RAB5C) in serum, plasma, tissue homogenates and other biological fluids.
Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit
SEP757Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB5C, Member RAS Oncogene Family (RAB5C) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB5C, Member RAS Oncogene Family (RAB5C) in serum, plasma, tissue homogenates and other biological fluids.
Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit
SEP757Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB5C, Member RAS Oncogene Family (RAB5C) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB5C, Member RAS Oncogene Family (RAB5C) in serum, plasma, tissue homogenates and other biological fluids.
Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit
SEP757Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB5C, Member RAS Oncogene Family (RAB5C) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB5C, Member RAS Oncogene Family (RAB5C) in serum, plasma, tissue homogenates and other biological fluids.
Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit
4-SEP757Hu
  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as RAB5C, Member RAS Oncogene Family elisa. Alternative names of the recognized antigen: RABL
  • RAB5CL
  • Ras-related protein Rab-5C
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human RAB5C, Member RAS Oncogene Family (RAB5C) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.
Human RAB5C, Member RAS Oncogene Family (RAB5C) CLIA Kit
20-abx496137
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
ELISA kit for Human RAB5C (RAB5C, Member RAS Oncogene Family)
ELK7498 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to RAB5C, Member RAS Oncogene Family (RAB5C). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody spec
  • Show more
Description: A sandwich ELISA kit for detection of RAB5C, Member RAS Oncogene Family from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
RAB5C, Member RAS Oncogene Family Protein
20-abx261048
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.
RAB5C, Member RAS Oncogene Family Human Recombinant Protein
PROTP51148 Regular: 20ug
EUR 317
Description: RAB5C Human Recombinant produced in E. coli is a single polypeptide chain containing 239 amino acids (1-216) and having a molecular mass of 25.9kDa. RAB5C is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.
RAB5C siRNA
20-abx930697
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
RAB5C siRNA
20-abx930698
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
RAB5C antibody
70R-9551 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal RAB5C antibody
RAB5C Antibody
ABD4406 100 ug
EUR 438
RAB5C Antibody
36745-100ul 100ul
EUR 252
RAB5C Antibody
DF4406 200ul
EUR 304
Description: RAB5C Antibody detects endogenous levels of total RAB5C.
RAB5C Antibody
1-CSB-PA097939
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RAB5C. Recognizes RAB5C from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:5000, WB:1:200-1:1000
RAB5C Antibody
1-CSB-PA040136
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RAB5C. Recognizes RAB5C from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000
RAB5C Antibody
1-CSB-PA041280
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RAB5C. Recognizes RAB5C from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000
RAB5C Antibody
1-CSB-PA019215DSR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RAB5C. Recognizes RAB5C from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
RAB5C Antibody
1-CSB-PA019215DSR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RAB5C. Recognizes RAB5C from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
Canine RAB5C ELISA KIT
ELI-37953d 96 Tests
EUR 928
Human Ras related protein Rab 5C(RAB5C) ELISA kit
E01R0384-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Ras related protein Rab 5C(RAB5C) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Ras related protein Rab 5C(RAB5C) ELISA kit
E01R0384-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Ras related protein Rab 5C(RAB5C) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Ras related protein Rab 5C(RAB5C) ELISA kit
E01R0384-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Ras related protein Rab 5C(RAB5C) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Ras- related protein Rab- 5C, RAB5C ELISA KIT
ELI-15069h 96 Tests
EUR 824
Human Ras-related protein Rab-5C (RAB5C)
1-CSB-EP019215HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 39.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Ras-related protein Rab-5C(RAB5C) expressed in E.coli
Rat Ras related protein Rab 5C(RAB5C) ELISA kit
E02R0384-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Ras related protein Rab 5C(RAB5C) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Ras related protein Rab 5C(RAB5C) ELISA kit
E02R0384-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Ras related protein Rab 5C(RAB5C) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Ras related protein Rab 5C(RAB5C) ELISA kit
E02R0384-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Ras related protein Rab 5C(RAB5C) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Ras related protein Rab 5C(RAB5C) ELISA kit
E03R0384-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Ras related protein Rab 5C(RAB5C) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Ras related protein Rab 5C(RAB5C) ELISA kit
E03R0384-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Ras related protein Rab 5C(RAB5C) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Ras related protein Rab 5C(RAB5C) ELISA kit
E03R0384-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Ras related protein Rab 5C(RAB5C) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Ras related protein Rab 5C(RAB5C) ELISA kit
E04R0384-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Ras related protein Rab 5C(RAB5C) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Ras related protein Rab 5C(RAB5C) ELISA kit
E04R0384-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Ras related protein Rab 5C(RAB5C) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Ras related protein Rab 5C(RAB5C) ELISA kit
E04R0384-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Ras related protein Rab 5C(RAB5C) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Ras related protein Rab 5C(RAB5C) ELISA kit
E06R0384-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Ras related protein Rab 5C(RAB5C) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Ras related protein Rab 5C(RAB5C) ELISA kit
E06R0384-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Ras related protein Rab 5C(RAB5C) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Ras related protein Rab 5C(RAB5C) ELISA kit
E06R0384-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Ras related protein Rab 5C(RAB5C) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Ras related protein Rab 5C(RAB5C) ELISA kit
E07R0384-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Ras related protein Rab 5C(RAB5C) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Ras related protein Rab 5C(RAB5C) ELISA kit
E07R0384-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Ras related protein Rab 5C(RAB5C) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Ras related protein Rab 5C(RAB5C) ELISA kit
E07R0384-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Ras related protein Rab 5C(RAB5C) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Ras related protein Rab 5C(RAB5C) ELISA kit
E08R0384-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Ras related protein Rab 5C(RAB5C) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Ras related protein Rab 5C(RAB5C) ELISA kit
E08R0384-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Ras related protein Rab 5C(RAB5C) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Ras related protein Rab 5C(RAB5C) ELISA kit
E08R0384-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Ras related protein Rab 5C(RAB5C) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Ras related protein Rab 5C(RAB5C) ELISA kit
E09R0384-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Ras related protein Rab 5C(RAB5C) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Ras related protein Rab 5C(RAB5C) ELISA kit
E09R0384-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Ras related protein Rab 5C(RAB5C) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Ras related protein Rab 5C(RAB5C) ELISA kit
E09R0384-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Ras related protein Rab 5C(RAB5C) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Bovine Ras- related protein Rab- 5C, RAB5C ELISA KIT
ELI-15068b 96 Tests
EUR 928
Mouse Ras- related protein Rab- 5C, Rab5c ELISA KIT
ELI-15070m 96 Tests
EUR 865
Chicken Ras- related protein Rab- 5C, RAB5C ELISA KIT
ELI-44428c 96 Tests
EUR 928
ELISA kit for Human Ras-related protein Rab-5C (RAB5C)
KTE60988-48T 48T
EUR 332
  • Members of the Rab protein family are small GTPases of the Ras superfamily that are thought to ensure fidelity in the process of docking and/or fusion of vesicles with their correct acceptor compartment. Han et al. (1996) isolated fetal lung cDNAs en
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Ras-related protein Rab-5C (RAB5C) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Ras-related protein Rab-5C (RAB5C)
KTE60988-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Members of the Rab protein family are small GTPases of the Ras superfamily that are thought to ensure fidelity in the process of docking and/or fusion of vesicles with their correct acceptor compartment. Han et al. (1996) isolated fetal lung cDNAs en
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Ras-related protein Rab-5C (RAB5C) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Ras-related protein Rab-5C (RAB5C)
KTE60988-96T 96T
EUR 539
  • Members of the Rab protein family are small GTPases of the Ras superfamily that are thought to ensure fidelity in the process of docking and/or fusion of vesicles with their correct acceptor compartment. Han et al. (1996) isolated fetal lung cDNAs en
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Ras-related protein Rab-5C (RAB5C) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
RAB5C Conjugated Antibody
C36745 100ul
EUR 397
RAB5C cloning plasmid
CSB-CL019215HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 651
  • Sequence: ATGGCGGGTCGGGGAGGCGCAGCACGACCCAATGGACCAGCTGCTGGGAACAAGATCTGTCAATTTAAGCTGGTTCTGCTGGGGGAGTCTGCGGTAGGCAAATCCAGCCTCGTCCTCCGCTTTGTCAAGGGACAGTTTCACGAGTACCAGGAGAGCACAATTGGAGCGGCCTTCCT
  • Show more
Description: A cloning plasmid for the RAB5C gene.
RAB5C Blocking Peptide
20-abx162145
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
Anti-RAB5C Antibody
A05148 100ul
EUR 397
Description: Rabbit Polyclonal RAB5C Antibody. Validated in WB and tested in Human, Mouse, Rat.
RAB5C Rabbit pAb
A7342-100ul 100 ul
EUR 308
RAB5C Rabbit pAb
A7342-200ul 200 ul
EUR 459
RAB5C Rabbit pAb
A7342-20ul 20 ul
EUR 183
RAB5C Rabbit pAb
A7342-50ul 50 ul
EUR 223
RAB5C Blocking Peptide
33R-4673 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RAB5C antibody, catalog no. 70R-9551
RAB5C Blocking Peptide
DF4406-BP 1mg
EUR 195

Human RAB5C(RAB5C, Member RAS Oncogene Family) ELISA Kit