Human HIST2H3A(Histone Cluster 2, H3a) ELISA Kit

Human HIST2H3A(Histone Cluster 2, H3a) ELISA Kit

To Order Contact us: [email protected]

Human Histone Cluster 2, H3a (HIST2H3A) ELISA Kit

4-SEQ849Hu
  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Histone Cluster 2, H3a elisa. Alternative names of the recognized antigen: H3/n
  • H3/o
  • HIST2H3D
  • HIST2H3C
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Histone Cluster 2, H3a (HIST2H3A) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Histone Cluster 2, H3a (HIST2H3A) Antibody

20-abx104778
  • EUR 481.00
  • EUR 133.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Histone Cluster 2, H3a (HIST2H3A) Antibody

20-abx124918
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Histone Cluster 2, H3a (HIST2H3A) Antibody

20-abx128666
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Histone Cluster 2, H3a (HIST2H3A) Antibody

abx031141-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Histone Cluster 2, H3a (HIST2H3A) Antibody

abx031141-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Recombinant Histone Cluster 2, H3a (HIST2H3A)

4-RPQ849Hu01
  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q71DI3
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 16.9kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Histone Cluster 2, H3a expressed in: E.coli

Recombinant Histone Cluster 2, H3a (HIST2H3A)

4-RPQ849Mu01
  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Inquire
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 16.9kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Histone Cluster 2, H3a expressed in: E.coli

Human Histone Cluster 2, H3a (HIST2H3A) Protein

20-abx067127
  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Human Histone Cluster 2, H3a (HIST2H3A) CLIA Kit

20-abx496211
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human HIST2H3A (Histone Cluster 2, H3a)

ELK7464 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Histone Cluster 2, H3a (HIST2H3A). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to
  • Show more
Description: A sandwich ELISA kit for detection of Histone Cluster 2, H3a from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Mouse Histone Cluster 2, H3a (HIST2H3A) Protein

20-abx652270
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Histone Cluster 2, H3a (HIST2H3A) Polyclonal Antibody (Chicken)

4-PAQ849Ga01
  • EUR 275.00
  • EUR 2958.00
  • EUR 727.00
  • EUR 350.00
  • EUR 226.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HIST2H3A (Ala2~Ala136)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Chicken Histone Cluster 2, H3a (HIST2H3A)

Histone Cluster 2, H3a (HIST2H3A) Polyclonal Antibody (Human, Rat)

4-PAQ849Hu01
  • EUR 261.00
  • EUR 2734.00
  • EUR 676.00
  • EUR 330.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HIST2H3A (Met1~Ala136)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Histone Cluster 2, H3a (HIST2H3A)

Histone Cluster 2, H3a (HIST2H3A) Polyclonal Antibody (Chicken), APC

4-PAQ849Ga01-APC
  • EUR 388.00
  • EUR 3887.00
  • EUR 1065.00
  • EUR 501.00
  • EUR 237.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HIST2H3A (Ala2~Ala136)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Chicken Histone Cluster 2, H3a (HIST2H3A). This antibody is labeled with APC.

Histone Cluster 2, H3a (HIST2H3A) Polyclonal Antibody (Chicken), Biotinylated

4-PAQ849Ga01-Biotin
  • EUR 343.00
  • EUR 2908.00
  • EUR 839.00
  • EUR 425.00
  • EUR 232.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HIST2H3A (Ala2~Ala136)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Chicken Histone Cluster 2, H3a (HIST2H3A). This antibody is labeled with Biotin.

Histone Cluster 2, H3a (HIST2H3A) Polyclonal Antibody (Chicken), Cy3

4-PAQ849Ga01-Cy3
  • EUR 476.00
  • EUR 5141.00
  • EUR 1379.00
  • EUR 626.00
  • EUR 275.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HIST2H3A (Ala2~Ala136)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Chicken Histone Cluster 2, H3a (HIST2H3A). This antibody is labeled with Cy3.

Histone Cluster 2, H3a (HIST2H3A) Polyclonal Antibody (Chicken), FITC

4-PAQ849Ga01-FITC
  • EUR 330.00
  • EUR 3129.00
  • EUR 872.00
  • EUR 420.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HIST2H3A (Ala2~Ala136)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Chicken Histone Cluster 2, H3a (HIST2H3A). This antibody is labeled with FITC.

Histone Cluster 2, H3a (HIST2H3A) Polyclonal Antibody (Chicken), HRP

4-PAQ849Ga01-HRP
  • EUR 353.00
  • EUR 3385.00
  • EUR 940.00
  • EUR 451.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HIST2H3A (Ala2~Ala136)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Chicken Histone Cluster 2, H3a (HIST2H3A). This antibody is labeled with HRP.

Histone Cluster 2, H3a (HIST2H3A) Polyclonal Antibody (Chicken), PE

4-PAQ849Ga01-PE
  • EUR 330.00
  • EUR 3129.00
  • EUR 872.00
  • EUR 420.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HIST2H3A (Ala2~Ala136)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Chicken Histone Cluster 2, H3a (HIST2H3A). This antibody is labeled with PE.

Histone Cluster 2, H3a (HIST2H3A) Polyclonal Antibody (Human, Rat), APC

4-PAQ849Hu01-APC
  • EUR 367.00
  • EUR 3581.00
  • EUR 989.00
  • EUR 470.00
  • EUR 228.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HIST2H3A (Met1~Ala136)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Histone Cluster 2, H3a (HIST2H3A). This antibody is labeled with APC.

Histone Cluster 2, H3a (HIST2H3A) Polyclonal Antibody (Human, Rat), Biotinylated

4-PAQ849Hu01-Biotin
  • EUR 327.00
  • EUR 2684.00
  • EUR 783.00
  • EUR 403.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HIST2H3A (Met1~Ala136)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Histone Cluster 2, H3a (HIST2H3A). This antibody is labeled with Biotin.

Histone Cluster 2, H3a (HIST2H3A) Polyclonal Antibody (Human, Rat), Cy3

4-PAQ849Hu01-Cy3
  • EUR 447.00
  • EUR 4733.00
  • EUR 1277.00
  • EUR 585.00
  • EUR 263.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HIST2H3A (Met1~Ala136)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Histone Cluster 2, H3a (HIST2H3A). This antibody is labeled with Cy3.

Histone Cluster 2, H3a (HIST2H3A) Polyclonal Antibody (Human, Rat), FITC

4-PAQ849Hu01-FITC
  • EUR 313.00
  • EUR 2884.00
  • EUR 811.00
  • EUR 396.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HIST2H3A (Met1~Ala136)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Histone Cluster 2, H3a (HIST2H3A). This antibody is labeled with FITC.

Histone Cluster 2, H3a (HIST2H3A) Polyclonal Antibody (Human, Rat), HRP

4-PAQ849Hu01-HRP
  • EUR 334.00
  • EUR 3120.00
  • EUR 873.00
  • EUR 424.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HIST2H3A (Met1~Ala136)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Histone Cluster 2, H3a (HIST2H3A). This antibody is labeled with HRP.

Histone Cluster 2, H3a (HIST2H3A) Polyclonal Antibody (Human, Rat), PE

4-PAQ849Hu01-PE
  • EUR 313.00
  • EUR 2884.00
  • EUR 811.00
  • EUR 396.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HIST2H3A (Met1~Ala136)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Histone Cluster 2, H3a (HIST2H3A). This antibody is labeled with PE.

Histone Cluster 2, H3a (HIST2H3A) Polyclonal Antibody (Chicken), APC-Cy7

4-PAQ849Ga01-APC-Cy7
  • EUR 657.00
  • EUR 7654.00
  • EUR 2011.00
  • EUR 882.00
  • EUR 355.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HIST2H3A (Ala2~Ala136)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Chicken Histone Cluster 2, H3a (HIST2H3A). This antibody is labeled with APC-Cy7.

Histone Cluster 2, H3a (HIST2H3A) Polyclonal Antibody (Human, Rat), APC-Cy7

4-PAQ849Hu01-APC-Cy7
  • EUR 614.00
  • EUR 7042.00
  • EUR 1858.00
  • EUR 821.00
  • EUR 337.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HIST2H3A (Met1~Ala136)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Histone Cluster 2, H3a (HIST2H3A). This antibody is labeled with APC-Cy7.

Histone Cluster 2, H3a Antibody

20-abx129722
  • EUR 467.00
  • EUR 133.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Histone H3.2, HIST2H3A ELISA KIT

ELI-47958h 96 Tests
EUR 824

Human Histone Cluster 2, H2be (HIST2H2BE) ELISA Kit

20-abx585323
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Human Histone Cluster 2, H2be (HIST2H2BE) ELISA Kit

20-abx585324
  • EUR 7504.00
  • EUR 3996.00
  • EUR 926.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Rat Histone Cluster 2, H2be (HIST2H2BE) ELISA Kit

20-abx585325
  • EUR 7911.00
  • EUR 4215.00
  • EUR 973.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Human Histone Cluster 2, H2be (HIST2H2BE) Protein

20-abx168051
  • EUR 620.00
  • EUR 272.00
  • EUR 1859.00
  • EUR 732.00
  • EUR 453.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Histone Cluster 2, H2aa3 (HIST2H2AA3) Protein

20-abx067125
  • EUR 690.00
  • EUR 286.00
  • EUR 2110.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Human Histone Cluster 2, H2ac (HIST2H2AC) Protein

20-abx067126
  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Histone Cluster 1, H1a (HIST1H1A) ELISA Kit

20-abx156773
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Histone Cluster 1, H2ab (HIST1H2AB) ELISA Kit

20-abx258163
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Histone Cluster 1, H4a (HIST1H4A) ELISA Kit

20-abx258903
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Histone Cluster 3, H3 (HIST3H3) ELISA Kit

20-abx385010
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Human Histone Cluster 1, H4a ELISA Kit (HIST1H4A)

RK01567 96 Tests
EUR 521

Human Histone Cluster 1, H4a (HIST1H4A) ELISA Kit

SEQ004Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Histone Cluster 1, H4a (HIST1H4A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Histone Cluster 1, H4a (HIST1H4A) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Histone Cluster 1, H4a (HIST1H4A) ELISA Kit

SEQ004Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Histone Cluster 1, H4a (HIST1H4A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Histone Cluster 1, H4a (HIST1H4A) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Histone Cluster 1, H4a (HIST1H4A) ELISA Kit

SEQ004Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Histone Cluster 1, H4a (HIST1H4A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Histone Cluster 1, H4a (HIST1H4A) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Histone Cluster 1, H4a (HIST1H4A) ELISA Kit

SEQ004Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Histone Cluster 1, H4a (HIST1H4A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Histone Cluster 1, H4a (HIST1H4A) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Histone Cluster 1, H4a (HIST1H4A) ELISA Kit

4-SEQ004Hu
  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Histone Cluster 1, H4a elisa. Alternative names of the recognized antigen: H4FA
  • HIST2H4B
  • HIST2H4C
  • HIST2H4D
  • HIST2H4E
  • HIST2H4F
  • HIST2H4G
  • HIST2H4H
  • HIST2H4I
  • HIST2H4J
  • HIST2H4K
  • HIST2H4B
  • HIST4H4
  • HIST2H4A
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Histone Cluster 1, H4a (HIST1H4A) in samples from tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Histone Cluster 1, H2ab (HIST1H2AB) ELISA Kit

SEQ021Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Histone Cluster 1, H2ab (HIST1H2AB) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Histone Cluster 1, H2ab (HIST1H2AB) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Histone Cluster 1, H2ab (HIST1H2AB) ELISA Kit

SEQ021Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Histone Cluster 1, H2ab (HIST1H2AB) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Histone Cluster 1, H2ab (HIST1H2AB) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Histone Cluster 1, H2ab (HIST1H2AB) ELISA Kit

SEQ021Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Histone Cluster 1, H2ab (HIST1H2AB) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Histone Cluster 1, H2ab (HIST1H2AB) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Histone Cluster 1, H2ab (HIST1H2AB) ELISA Kit

SEQ021Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Histone Cluster 1, H2ab (HIST1H2AB) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Histone Cluster 1, H2ab (HIST1H2AB) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Histone Cluster 1, H2ab (HIST1H2AB) ELISA Kit

4-SEQ021Hu
  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Histone Cluster 1, H2ab elisa. Alternative names of the recognized antigen: HIST1H2AE
  • H2AFM
  • H2A/m
  • H2A Histone Family Member M
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Histone Cluster 1, H2ab (HIST1H2AB) in samples from tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Histone Cluster 1, H1a (HIST1H1A) ELISA Kit

SEJ782Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Histone Cluster 1, H1a (HIST1H1A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Histone Cluster 1, H1a (HIST1H1A) in Tissue homogenates, cell lysates and other biological fluids.

Human Histone Cluster 1, H1a (HIST1H1A) ELISA Kit

SEJ782Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Histone Cluster 1, H1a (HIST1H1A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Histone Cluster 1, H1a (HIST1H1A) in Tissue homogenates, cell lysates and other biological fluids.

Human Histone Cluster 1, H1a (HIST1H1A) ELISA Kit

SEJ782Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Histone Cluster 1, H1a (HIST1H1A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Histone Cluster 1, H1a (HIST1H1A) in Tissue homogenates, cell lysates and other biological fluids.

Human Histone Cluster 1, H1a (HIST1H1A) ELISA Kit

SEJ782Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Histone Cluster 1, H1a (HIST1H1A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Histone Cluster 1, H1a (HIST1H1A) in Tissue homogenates, cell lysates and other biological fluids.

Human Histone Cluster 1, H1a (HIST1H1A) ELISA Kit

4-SEJ782Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Histone Cluster 1, H1a elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Histone Cluster 1, H1a (HIST1H1A) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Histone Cluster 2, H2aa3 (HIST2H2AA3) Antibody

abx027547-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Histone Cluster 2, H2aa3 (HIST2H2AA3) Antibody

abx027547-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Histone Cluster 2, H2ac (HIST2H2AC) Antibody

20-abx102878
  • EUR 453.00
  • EUR 133.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Histone Cluster 2, H2aa3 (HIST2H2AA3) Antibody

20-abx103153
  • EUR 453.00
  • EUR 133.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Histone Cluster 2, H2be (HIST2H2BE) Antibody

20-abx113029
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Histone Cluster 2, H2be (HIST2H2BE) Antibody

20-abx128664
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Histone Cluster 2, H2ac (HIST2H2AC) Antibody

abx031289-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Histone Cluster 2, H2ac (HIST2H2AC) Antibody

abx031289-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Histone Cluster 2, H2ac (HIST2H2AC) Antibody

20-abx301208
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Recombinant Histone Cluster 2, H2be (HIST2H2BE)

4-RPQ006Hu01
  • EUR 440.48
  • EUR 221.00
  • EUR 1376.80
  • EUR 525.60
  • EUR 951.20
  • EUR 358.00
  • EUR 3292.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q16778
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 17.6kDa
  • Isoelectric Point: 10.4
Description: Recombinant Human Histone Cluster 2, H2be expressed in: E.coli

Recombinant Histone Cluster 2, H2ac (HIST2H2AC)

4-RPQ018Hu01
  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q16777
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 44.0kDa
  • Isoelectric Point: 10.9
Description: Recombinant Human Histone Cluster 2, H2ac expressed in: E.coli

Recombinant Histone Cluster 2, H2aa3 (HIST2H2AA3)

4-RPQ019Hu01
  • EUR 490.66
  • EUR 234.00
  • EUR 1564.96
  • EUR 588.32
  • EUR 1076.64
  • EUR 391.00
  • EUR 3762.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q6FI13
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 40.9kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Histone Cluster 2, H2aa3 expressed in: E.coli

Histone Cluster 1, H4a (HIST1H4A) ELISA Kit

20-abx258202
  • EUR 7504.00
  • EUR 3996.00
  • EUR 926.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

HIST2H3A Antibody

1-CSB-PA744479HA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HIST2H3A. Recognizes HIST2H3A from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IF:1:50-1:200

HIST2H3A siRNA

20-abx919520
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Histone Cluster 2, H2be (HIST2H2BE) Polyclonal Antibody (Human)

4-PAQ006Hu01
  • EUR 261.00
  • EUR 2734.00
  • EUR 676.00
  • EUR 330.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HIST2H2BE (Pro2~Lys126)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Histone Cluster 2, H2be (HIST2H2BE)

Histone Cluster 2, H2ac (HIST2H2AC) Polyclonal Antibody (Human)

4-PAQ018Hu01
  • EUR 262.00
  • EUR 2747.00
  • EUR 679.00
  • EUR 331.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HIST2H2AC (Met1~Lys129)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Histone Cluster 2, H2ac (HIST2H2AC)

Histone Cluster 2, H2aa3 (HIST2H2AA3) Polyclonal Antibody (Human)

4-PAQ019Hu01
  • EUR 262.00
  • EUR 2747.00
  • EUR 679.00
  • EUR 331.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HIST2H2AA3 (Met1~Lys130)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Histone Cluster 2, H2aa3 (HIST2H2AA3)

ELISA kit for Human HIST1H1A (Histone Cluster 1, H1a)

ELK5025 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Histone Cluster 1, H1a (HIST1H1A). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to
  • Show more
Description: A sandwich ELISA kit for detection of Histone Cluster 1, H1a from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human HIST1H2AB (Histone Cluster 1, H2ab)

ELK7466 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Histone Cluster 1, H2ab (HIST1H2AB). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific t
  • Show more
Description: A sandwich ELISA kit for detection of Histone Cluster 1, H2ab from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human HIST1H4A (Histone Cluster 1, H4a)

ELK7766 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Histone Cluster 1, H4a (HIST1H4A). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to
  • Show more
Description: A sandwich ELISA kit for detection of Histone Cluster 1, H4a from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human HIST1H4A (Histone Cluster 1, H4a)

ELK8131 1 plate of 96 wells
EUR 372
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Histone Cluster 1, H4a (HIST1H4A). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to
  • Show more
Description: A sandwich ELISA kit for detection of Histone Cluster 1, H4a from Human,Mouse,Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Histone Cluster 2, H4b (HIST2H4B AcK8) Antibody

abx412437-01ml 0.1 ml
EUR 801
  • Shipped within 1 week.

Histone Cluster 2, H2aa3 (HIST2H2AA3) Antibody (FITC)

20-abx271130
  • EUR 509.00
  • EUR 258.00
  • EUR 1539.00
  • EUR 718.00
  • EUR 411.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Histone Cluster 2, H2ac (HIST2H2AC) Antibody (FITC)

20-abx271131
  • EUR 509.00
  • EUR 258.00
  • EUR 1539.00
  • EUR 718.00
  • EUR 411.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Histone Cluster 2, H2aa3 (HIST2H2AA3) Antibody (Biotin)

20-abx271396
  • EUR 481.00
  • EUR 244.00
  • EUR 1428.00
  • EUR 676.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Histone Cluster 2, H2ac (HIST2H2AC) Antibody (Biotin)

20-abx271397
  • EUR 481.00
  • EUR 244.00
  • EUR 1428.00
  • EUR 676.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Histone Cluster 2, H2be (HIST2H2BE) Antibody Pair

20-abx370809
  • EUR 1762.00
  • EUR 1121.00
  • 10 × 96 tests
  • 5 × 96 tests
  • Shipped within 5-15 working days.

Histone Cluster 2, H2be (HIST2H2BE) Antibody Pair

20-abx370816
  • EUR 1817.00
  • EUR 1163.00
  • 10 × 96 tests
  • 5 × 96 tests
  • Shipped within 5-15 working days.

Histone Cluster 2, H2be (HIST2H2BE) Antibody Pair

20-abx370817
  • EUR 1887.00
  • EUR 1205.00
  • 10 × 96 tests
  • 5 × 96 tests
  • Shipped within 5-15 working days.

Histone Cluster 2, H2ac (HIST2H2AC) Antibody (HRP)

20-abx304155
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Histone Cluster 2, H2ac (HIST2H2AC) Antibody (FITC)

20-abx304156
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Histone Cluster 2, H2ac (HIST2H2AC) Antibody (Biotin)

20-abx304157
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Cow Histone Cluster 1, H4a (HIST1H4A) ELISA Kit

20-abx258900
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Histone Cluster 1, H4a (HIST1H4A) ELISA Kit

20-abx258901
  • EUR 7645.00
  • EUR 4074.00
  • EUR 942.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Histone Cluster 1, H4a (HIST1H4A) ELISA Kit

20-abx258902
  • EUR 7504.00
  • EUR 3996.00
  • EUR 926.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Histone Cluster 1, H2ab (HIST1H2AB) ELISA Kit

20-abx585312
  • EUR 7911.00
  • EUR 4215.00
  • EUR 973.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Mouse Histone Cluster 1, H2ab (HIST1H2AB) ELISA Kit

20-abx585313
  • EUR 7504.00
  • EUR 3996.00
  • EUR 926.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Mouse Histone Cluster 1, H4a ELISA Kit (HIST1H4A)

RK02892 96 Tests
EUR 521

Cattle Histone Cluster 1, H4a (HIST1H4A) ELISA Kit

SEQ004Bo-10x96wellstestplate 10x96-wells test plate
EUR 5922.69
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Histone Cluster 1, H4a (HIST1H4A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Histone Cluster 1, H4a (HIST1H4A) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Cattle Histone Cluster 1, H4a (HIST1H4A) ELISA Kit

SEQ004Bo-1x48wellstestplate 1x48-wells test plate
EUR 575.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Histone Cluster 1, H4a (HIST1H4A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Histone Cluster 1, H4a (HIST1H4A) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Cattle Histone Cluster 1, H4a (HIST1H4A) ELISA Kit

SEQ004Bo-1x96wellstestplate 1x96-wells test plate
EUR 779.14
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Histone Cluster 1, H4a (HIST1H4A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Histone Cluster 1, H4a (HIST1H4A) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Cattle Histone Cluster 1, H4a (HIST1H4A) ELISA Kit

SEQ004Bo-5x96wellstestplate 5x96-wells test plate
EUR 3206.13
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Histone Cluster 1, H4a (HIST1H4A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Histone Cluster 1, H4a (HIST1H4A) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Cattle Histone Cluster 1, H4a (HIST1H4A) ELISA Kit

4-SEQ004Bo
  • EUR 5973.00
  • EUR 3157.00
  • EUR 780.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Histone Cluster 1, H4a elisa. Alternative names of the recognized antigen: H4FA
  • HIST2H4B
  • HIST2H4C
  • HIST2H4D
  • HIST2H4E
  • HIST2H4F
  • HIST2H4G
  • HIST2H4H
  • HIST2H4I
  • HIST2H4J
  • HIST2H4K
  • HIST2H4B
  • HIST4H4
  • HIST2H4A
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Cattle Histone Cluster 1, H4a (HIST1H4A) in samples from tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Histone Cluster 1, H4a (HIST1H4A) ELISA Kit

SEQ004Mu-10x96wellstestplate 10x96-wells test plate
EUR 5098.02
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Histone Cluster 1, H4a (HIST1H4A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Histone Cluster 1, H4a (HIST1H4A) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Mouse Histone Cluster 1, H4a (HIST1H4A) ELISA Kit

SEQ004Mu-1x48wellstestplate 1x48-wells test plate
EUR 507.48
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Histone Cluster 1, H4a (HIST1H4A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Histone Cluster 1, H4a (HIST1H4A) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Mouse Histone Cluster 1, H4a (HIST1H4A) ELISA Kit

SEQ004Mu-1x96wellstestplate 1x96-wells test plate
EUR 682.12
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Histone Cluster 1, H4a (HIST1H4A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Histone Cluster 1, H4a (HIST1H4A) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Mouse Histone Cluster 1, H4a (HIST1H4A) ELISA Kit

SEQ004Mu-5x96wellstestplate 5x96-wells test plate
EUR 2769.54
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Histone Cluster 1, H4a (HIST1H4A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Histone Cluster 1, H4a (HIST1H4A) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Mouse Histone Cluster 1, H4a (HIST1H4A) ELISA Kit

4-SEQ004Mu
  • EUR 5149.00
  • EUR 2720.00
  • EUR 683.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Histone Cluster 1, H4a elisa. Alternative names of the recognized antigen: H4FA
  • HIST2H4B
  • HIST2H4C
  • HIST2H4D
  • HIST2H4E
  • HIST2H4F
  • HIST2H4G
  • HIST2H4H
  • HIST2H4I
  • HIST2H4J
  • HIST2H4K
  • HIST2H4B
  • HIST4H4
  • HIST2H4A
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Histone Cluster 1, H4a (HIST1H4A) in samples from tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Histone Cluster 1, H4a (HIST1H4A) ELISA Kit

SEQ004Ra-10x96wellstestplate 10x96-wells test plate
EUR 5372.91
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Histone Cluster 1, H4a (HIST1H4A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Histone Cluster 1, H4a (HIST1H4A) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Histone Cluster 1, H4a (HIST1H4A) ELISA Kit

SEQ004Ra-1x48wellstestplate 1x48-wells test plate
EUR 530.12
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Histone Cluster 1, H4a (HIST1H4A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Histone Cluster 1, H4a (HIST1H4A) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Histone Cluster 1, H4a (HIST1H4A) ELISA Kit

SEQ004Ra-1x96wellstestplate 1x96-wells test plate
EUR 714.46
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Histone Cluster 1, H4a (HIST1H4A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Histone Cluster 1, H4a (HIST1H4A) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Histone Cluster 1, H4a (HIST1H4A) ELISA Kit

SEQ004Ra-5x96wellstestplate 5x96-wells test plate
EUR 2915.07
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Histone Cluster 1, H4a (HIST1H4A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Histone Cluster 1, H4a (HIST1H4A) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Histone Cluster 1, H4a (HIST1H4A) ELISA Kit

4-SEQ004Ra
  • EUR 5423.00
  • EUR 2866.00
  • EUR 715.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Histone Cluster 1, H4a elisa. Alternative names of the recognized antigen: H4FA
  • HIST2H4B
  • HIST2H4C
  • HIST2H4D
  • HIST2H4E
  • HIST2H4F
  • HIST2H4G
  • HIST2H4H
  • HIST2H4I
  • HIST2H4J
  • HIST2H4K
  • HIST2H4B
  • HIST4H4
  • HIST2H4A
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Histone Cluster 1, H4a (HIST1H4A) in samples from tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human HIST2H3A shRNA Plasmid

20-abx967204
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

HIST2H3A sgRNA CRISPR Lentivector (Human) (Target 2)

K0961203 1.0 ug DNA
EUR 154

Histone Cluster 2, H2be (HIST2H2BE) Polyclonal Antibody (Human), APC

4-PAQ006Hu01-APC
  • EUR 367.00
  • EUR 3581.00
  • EUR 989.00
  • EUR 470.00
  • EUR 228.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HIST2H2BE (Pro2~Lys126)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Histone Cluster 2, H2be (HIST2H2BE). This antibody is labeled with APC.

Histone Cluster 2, H2be (HIST2H2BE) Polyclonal Antibody (Human), Biotinylated

4-PAQ006Hu01-Biotin
  • EUR 327.00
  • EUR 2684.00
  • EUR 783.00
  • EUR 403.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HIST2H2BE (Pro2~Lys126)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Histone Cluster 2, H2be (HIST2H2BE). This antibody is labeled with Biotin.

Histone Cluster 2, H2be (HIST2H2BE) Polyclonal Antibody (Human), Cy3

4-PAQ006Hu01-Cy3
  • EUR 447.00
  • EUR 4733.00
  • EUR 1277.00
  • EUR 585.00
  • EUR 263.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HIST2H2BE (Pro2~Lys126)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Histone Cluster 2, H2be (HIST2H2BE). This antibody is labeled with Cy3.

Histone Cluster 2, H2be (HIST2H2BE) Polyclonal Antibody (Human), FITC

4-PAQ006Hu01-FITC
  • EUR 313.00
  • EUR 2884.00
  • EUR 811.00
  • EUR 396.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HIST2H2BE (Pro2~Lys126)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Histone Cluster 2, H2be (HIST2H2BE). This antibody is labeled with FITC.

Histone Cluster 2, H2be (HIST2H2BE) Polyclonal Antibody (Human), HRP

4-PAQ006Hu01-HRP
  • EUR 334.00
  • EUR 3120.00
  • EUR 873.00
  • EUR 424.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HIST2H2BE (Pro2~Lys126)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Histone Cluster 2, H2be (HIST2H2BE). This antibody is labeled with HRP.

Histone Cluster 2, H2be (HIST2H2BE) Polyclonal Antibody (Human), PE

4-PAQ006Hu01-PE
  • EUR 313.00
  • EUR 2884.00
  • EUR 811.00
  • EUR 396.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HIST2H2BE (Pro2~Lys126)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Histone Cluster 2, H2be (HIST2H2BE). This antibody is labeled with PE.

Histone Cluster 2, H2ac (HIST2H2AC) Polyclonal Antibody (Human), APC

4-PAQ018Hu01-APC
  • EUR 368.00
  • EUR 3599.00
  • EUR 993.00
  • EUR 472.00
  • EUR 229.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HIST2H2AC (Met1~Lys129)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Histone Cluster 2, H2ac (HIST2H2AC). This antibody is labeled with APC.

Histone Cluster 2, H2ac (HIST2H2AC) Polyclonal Antibody (Human), Biotinylated

4-PAQ018Hu01-Biotin
  • EUR 328.00
  • EUR 2697.00
  • EUR 786.00
  • EUR 404.00
  • EUR 226.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HIST2H2AC (Met1~Lys129)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Histone Cluster 2, H2ac (HIST2H2AC). This antibody is labeled with Biotin.

Histone Cluster 2, H2ac (HIST2H2AC) Polyclonal Antibody (Human), Cy3

4-PAQ018Hu01-Cy3
  • EUR 449.00
  • EUR 4757.00
  • EUR 1283.00
  • EUR 588.00
  • EUR 264.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HIST2H2AC (Met1~Lys129)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Histone Cluster 2, H2ac (HIST2H2AC). This antibody is labeled with Cy3.

Histone Cluster 2, H2ac (HIST2H2AC) Polyclonal Antibody (Human), FITC

4-PAQ018Hu01-FITC
  • EUR 314.00
  • EUR 2899.00
  • EUR 814.00
  • EUR 397.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HIST2H2AC (Met1~Lys129)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Histone Cluster 2, H2ac (HIST2H2AC). This antibody is labeled with FITC.

Histone Cluster 2, H2ac (HIST2H2AC) Polyclonal Antibody (Human), HRP

4-PAQ018Hu01-HRP
  • EUR 335.00
  • EUR 3135.00
  • EUR 877.00
  • EUR 426.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HIST2H2AC (Met1~Lys129)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Histone Cluster 2, H2ac (HIST2H2AC). This antibody is labeled with HRP.

Histone Cluster 2, H2ac (HIST2H2AC) Polyclonal Antibody (Human), PE

4-PAQ018Hu01-PE
  • EUR 314.00
  • EUR 2899.00
  • EUR 814.00
  • EUR 397.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HIST2H2AC (Met1~Lys129)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Histone Cluster 2, H2ac (HIST2H2AC). This antibody is labeled with PE.

Histone Cluster 2, H2aa3 (HIST2H2AA3) Polyclonal Antibody (Human), APC

4-PAQ019Hu01-APC
  • EUR 368.00
  • EUR 3599.00
  • EUR 993.00
  • EUR 472.00
  • EUR 229.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HIST2H2AA3 (Met1~Lys130)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Histone Cluster 2, H2aa3 (HIST2H2AA3). This antibody is labeled with APC.

Histone Cluster 2, H2aa3 (HIST2H2AA3) Polyclonal Antibody (Human), Biotinylated

4-PAQ019Hu01-Biotin
  • EUR 328.00
  • EUR 2697.00
  • EUR 786.00
  • EUR 404.00
  • EUR 226.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HIST2H2AA3 (Met1~Lys130)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Histone Cluster 2, H2aa3 (HIST2H2AA3). This antibody is labeled with Biotin.

Histone Cluster 2, H2aa3 (HIST2H2AA3) Polyclonal Antibody (Human), Cy3

4-PAQ019Hu01-Cy3
  • EUR 449.00
  • EUR 4757.00
  • EUR 1283.00
  • EUR 588.00
  • EUR 264.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HIST2H2AA3 (Met1~Lys130)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Histone Cluster 2, H2aa3 (HIST2H2AA3). This antibody is labeled with Cy3.

Histone Cluster 2, H2aa3 (HIST2H2AA3) Polyclonal Antibody (Human), FITC

4-PAQ019Hu01-FITC
  • EUR 314.00
  • EUR 2899.00
  • EUR 814.00
  • EUR 397.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HIST2H2AA3 (Met1~Lys130)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Histone Cluster 2, H2aa3 (HIST2H2AA3). This antibody is labeled with FITC.

Histone Cluster 2, H2aa3 (HIST2H2AA3) Polyclonal Antibody (Human), HRP

4-PAQ019Hu01-HRP
  • EUR 335.00
  • EUR 3135.00
  • EUR 877.00
  • EUR 426.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HIST2H2AA3 (Met1~Lys130)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Histone Cluster 2, H2aa3 (HIST2H2AA3). This antibody is labeled with HRP.

Histone Cluster 2, H2aa3 (HIST2H2AA3) Polyclonal Antibody (Human), PE

4-PAQ019Hu01-PE
  • EUR 314.00
  • EUR 2899.00
  • EUR 814.00
  • EUR 397.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HIST2H2AA3 (Met1~Lys130)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Histone Cluster 2, H2aa3 (HIST2H2AA3). This antibody is labeled with PE.

Human Histone Cluster 1, H1a (HIST1H1A) CLIA Kit

20-abx495780
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Histone Cluster 1, H2ab (HIST1H2AB) CLIA Kit

20-abx496151
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Histone Cluster 1, H4a (HIST1H4A) CLIA Kit

20-abx496541
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

HIST2H3A cloning plasmid

CSB-CL744479HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 411
  • Sequence: atggcccgtactaagcagactgctcgcaagtcgaccggcggcaaggccccgaggaagcagctggccaccaaggcggcccgcaagagcgcgccggccacgggcggggtgaagaagccgcaccgctaccggcccggcaccgtagccctgcgggagatccggcgctaccagaagtccac
  • Show more
Description: A cloning plasmid for the HIST2H3A gene.

HIST2H3A Rabbit pAb

A9249-100ul 100 ul
EUR 308

HIST2H3A Rabbit pAb

A9249-200ul 200 ul
EUR 459

HIST2H3A Rabbit pAb

A9249-20ul 20 ul Ask for price

HIST2H3A Rabbit pAb

A9249-50ul 50 ul Ask for price

Anti-HIST2H3A antibody

STJ111627 100 µl
EUR 277
Description: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. This structure consists of approximately 146 bp of DNA wrapped around a nucleosome, an octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H3 family. Transcripts from this gene lack polyA tails; instead, they contain a palindromic termination element. This gene is found in a histone cluster on chromosome 1. This gene is one of four histone genes in the cluster that are duplicated; this record represents the centromeric copy.

Human Histone Deacetylase 2 ELISA kit

E01H0235-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Histone Deacetylase 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Histone Deacetylase 2 ELISA kit

E01H0235-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Histone Deacetylase 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Histone Deacetylase 2 ELISA kit

E01H0235-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Histone Deacetylase 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Mouse HIST1H4A (Histone Cluster 1, H4a)

ELK7734 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Histone Cluster 1, H4a (HIST1H4A). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to
  • Show more
Description: A sandwich ELISA kit for detection of Histone Cluster 1, H4a from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Cattle HIST1H4A (Histone Cluster 1, H4a)

ELK8251 1 plate of 96 wells
EUR 526
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Histone Cluster 1, H4a (HIST1H4A). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to
  • Show more
Description: A sandwich ELISA kit for detection of Histone Cluster 1, H4a from Cattle in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Rat HIST1H4A (Histone Cluster 1, H4a)

ELK8252 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Histone Cluster 1, H4a (HIST1H4A). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to
  • Show more
Description: A sandwich ELISA kit for detection of Histone Cluster 1, H4a from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Multi-species Histone Cluster 1, H4a (HIST1H4A) ELISA Kit

SEQ004Mi-10x96wellstestplate 10x96-wells test plate
EUR 5333.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Multi-species Histone Cluster 1, H4a (HIST1H4A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Multi-species Histone Cluster 1, H4a (HIST1H4A) in Tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Multi-species Histone Cluster 1, H4a (HIST1H4A) ELISA Kit

SEQ004Mi-1x48wellstestplate 1x48-wells test plate
EUR 526.89
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Multi-species Histone Cluster 1, H4a (HIST1H4A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Multi-species Histone Cluster 1, H4a (HIST1H4A) in Tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Multi-species Histone Cluster 1, H4a (HIST1H4A) ELISA Kit

SEQ004Mi-1x96wellstestplate 1x96-wells test plate
EUR 709.84
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Multi-species Histone Cluster 1, H4a (HIST1H4A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Multi-species Histone Cluster 1, H4a (HIST1H4A) in Tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Multi-species Histone Cluster 1, H4a (HIST1H4A) ELISA Kit

SEQ004Mi-5x96wellstestplate 5x96-wells test plate
EUR 2894.28
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Multi-species Histone Cluster 1, H4a (HIST1H4A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Multi-species Histone Cluster 1, H4a (HIST1H4A) in Tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Multi-species Histone Cluster 1, H4a (HIST1H4A) ELISA Kit

4-SEQ004Mi
  • EUR 5384.00
  • EUR 2845.00
  • EUR 710.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Histone Cluster 1, H4a elisa. Alternative names of the recognized antigen: H4FA
  • HIST2H4B
  • HIST2H4C
  • HIST2H4D
  • HIST2H4E
  • HIST2H4F
  • HIST2H4G
  • HIST2H4H
  • HIST2H4I
  • HIST2H4J
  • HIST2H4K
  • HIST2H4B
  • HIST4H4
  • HIST2H4A
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Multi-species Histone Cluster 1, H4a (HIST1H4A) in samples from Tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Histone Cluster 1, H1C Antibody

20-abx113027
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Histone Cluster 1, H4a (HIST1H4A) CLIA Kit

20-abx496150
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS

AP-STR-KIT-2 1/pk
EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Histone Cluster 2, H2be (HIST2H2BE) Polyclonal Antibody (Human), APC-Cy7

4-PAQ006Hu01-APC-Cy7
  • EUR 614.00
  • EUR 7042.00
  • EUR 1858.00
  • EUR 821.00
  • EUR 337.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HIST2H2BE (Pro2~Lys126)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Histone Cluster 2, H2be (HIST2H2BE). This antibody is labeled with APC-Cy7.

Histone Cluster 2, H2ac (HIST2H2AC) Polyclonal Antibody (Human), APC-Cy7

4-PAQ018Hu01-APC-Cy7
  • EUR 616.00
  • EUR 7078.00
  • EUR 1867.00
  • EUR 824.00
  • EUR 338.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HIST2H2AC (Met1~Lys129)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Histone Cluster 2, H2ac (HIST2H2AC). This antibody is labeled with APC-Cy7.

Histone Cluster 2, H2aa3 (HIST2H2AA3) Polyclonal Antibody (Human), APC-Cy7

4-PAQ019Hu01-APC-Cy7
  • EUR 616.00
  • EUR 7078.00
  • EUR 1867.00
  • EUR 824.00
  • EUR 338.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HIST2H2AA3 (Met1~Lys130)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Histone Cluster 2, H2aa3 (HIST2H2AA3). This antibody is labeled with APC-Cy7.

Anti-Histone H3 Antibody

A12477-2 100ug/vial
EUR 294

HIST2H3A ORF Vector (Human) (pORF)

ORF020778 1.0 ug DNA
EUR 405

Human Histone Cluster 1, H2aa (HIST1H2AA) Protein

20-abx067117
  • EUR 676.00
  • EUR 286.00
  • EUR 2082.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Human Histone Cluster 1, H2ab (HIST1H2AB) Protein

20-abx067118
  • EUR 662.00
  • EUR 272.00
  • EUR 2026.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Human Histone Cluster 1, H2ac (HIST1H2AC) Protein

20-abx067119
  • EUR 676.00
  • EUR 286.00
  • EUR 2082.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Human Histone Cluster 1, H2ad (HIST1H2AD) Protein

20-abx067120
  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Human Histone Cluster 1, H2ag (HIST1H2AG) Protein

20-abx067121
  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Human Histone Cluster 1, H2ah (HIST1H2AH) Protein

20-abx067122
  • EUR 676.00
  • EUR 286.00
  • EUR 2082.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Human Histone Cluster 1, H2aj (HIST1H2AJ) Protein

20-abx067123
  • EUR 690.00
  • EUR 286.00
  • EUR 2110.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Human Histone Cluster 3, H2a (HIST3H2A) Protein

20-abx067128
  • EUR 690.00
  • EUR 286.00
  • EUR 2110.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Human Histone Cluster 1, H1a (HIST1H1A) Protein

20-abx653759
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug