Human HIST2H3A(Histone Cluster 2, H3a) ELISA Kit
To Order Contact us: [email protected]
Recombinant Histone Cluster 2, H3a (HIST2H3A) |
4-RPQ849Hu01 |
Cloud-Clone |
-
EUR 467.36
-
EUR 228.00
-
EUR 1477.60
-
EUR 559.20
-
EUR 1018.40
-
EUR 376.00
-
EUR 3544.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q71DI3
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 16.9kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Histone Cluster 2, H3a expressed in: E.coli |
Recombinant Histone Cluster 2, H3a (HIST2H3A) |
4-RPQ849Mu01 |
Cloud-Clone |
-
EUR 413.60
-
EUR 214.00
-
EUR 1276.00
-
EUR 492.00
-
EUR 884.00
-
EUR 340.00
-
EUR 3040.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Inquire
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 16.9kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Mouse Histone Cluster 2, H3a expressed in: E.coli |
Human Histone Cluster 2, H3a (HIST2H3A) ELISA Kit |
20-abx258161 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Histone Cluster 2, H3a (HIST2H3A) ELISA Kit |
SEQ849Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5189.65 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Histone Cluster 2, H3a (HIST2H3A) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Histone Cluster 2, H3a (HIST2H3A) in Tissue homogenates, cell lysates and other biological fluids. |
Human Histone Cluster 2, H3a (HIST2H3A) ELISA Kit |
SEQ849Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 515.03 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Histone Cluster 2, H3a (HIST2H3A) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Histone Cluster 2, H3a (HIST2H3A) in Tissue homogenates, cell lysates and other biological fluids. |
Human Histone Cluster 2, H3a (HIST2H3A) ELISA Kit |
SEQ849Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 692.9 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Histone Cluster 2, H3a (HIST2H3A) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Histone Cluster 2, H3a (HIST2H3A) in Tissue homogenates, cell lysates and other biological fluids. |
Human Histone Cluster 2, H3a (HIST2H3A) ELISA Kit |
SEQ849Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2818.05 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Histone Cluster 2, H3a (HIST2H3A) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Histone Cluster 2, H3a (HIST2H3A) in Tissue homogenates, cell lysates and other biological fluids. |
Human Histone Cluster 2, H3a (HIST2H3A) ELISA Kit |
4-SEQ849Hu |
Cloud-Clone |
-
EUR 5240.00
-
EUR 2769.00
-
EUR 693.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Histone Cluster 2, H3a elisa. Alternative names of the recognized antigen: H3/n
- H3/o
- HIST2H3D
- HIST2H3C
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Histone Cluster 2, H3a (HIST2H3A) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Human Histone Cluster 2, H3a (HIST2H3A) Protein |
20-abx067127 |
Abbexa |
-
EUR 648.00
-
EUR 272.00
-
EUR 1998.00
-
EUR 773.00
-
EUR 467.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Human Histone Cluster 2, H3a (HIST2H3A) CLIA Kit |
20-abx496211 |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
ELISA kit for Human HIST2H3A (Histone Cluster 2, H3a) |
ELK7464 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Histone Cluster 2, H3a (HIST2H3A). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to
- Show more
|
Description: A sandwich ELISA kit for detection of Histone Cluster 2, H3a from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Mouse Histone Cluster 2, H3a (HIST2H3A) Protein |
20-abx652270 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Histone Cluster 2, H3a (HIST2H3A) Polyclonal Antibody (Chicken) |
4-PAQ849Ga01 |
Cloud-Clone |
-
EUR 275.00
-
EUR 2958.00
-
EUR 727.00
-
EUR 350.00
-
EUR 226.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HIST2H3A (Ala2~Ala136)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Chicken Histone Cluster 2, H3a (HIST2H3A) |
Histone Cluster 2, H3a (HIST2H3A) Polyclonal Antibody (Human, Rat) |
4-PAQ849Hu01 |
Cloud-Clone |
-
EUR 261.00
-
EUR 2734.00
-
EUR 676.00
-
EUR 330.00
-
EUR 220.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HIST2H3A (Met1~Ala136)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Histone Cluster 2, H3a (HIST2H3A) |
Histone Cluster 2, H3a (HIST2H3A) Polyclonal Antibody (Chicken), APC |
4-PAQ849Ga01-APC |
Cloud-Clone |
-
EUR 388.00
-
EUR 3887.00
-
EUR 1065.00
-
EUR 501.00
-
EUR 237.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HIST2H3A (Ala2~Ala136)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Chicken Histone Cluster 2, H3a (HIST2H3A). This antibody is labeled with APC. |
Histone Cluster 2, H3a (HIST2H3A) Polyclonal Antibody (Chicken), Biotinylated |
4-PAQ849Ga01-Biotin |
Cloud-Clone |
-
EUR 343.00
-
EUR 2908.00
-
EUR 839.00
-
EUR 425.00
-
EUR 232.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HIST2H3A (Ala2~Ala136)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Chicken Histone Cluster 2, H3a (HIST2H3A). This antibody is labeled with Biotin. |
Histone Cluster 2, H3a (HIST2H3A) Polyclonal Antibody (Chicken), Cy3 |
4-PAQ849Ga01-Cy3 |
Cloud-Clone |
-
EUR 476.00
-
EUR 5141.00
-
EUR 1379.00
-
EUR 626.00
-
EUR 275.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HIST2H3A (Ala2~Ala136)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Chicken Histone Cluster 2, H3a (HIST2H3A). This antibody is labeled with Cy3. |
Histone Cluster 2, H3a (HIST2H3A) Polyclonal Antibody (Chicken), FITC |
4-PAQ849Ga01-FITC |
Cloud-Clone |
-
EUR 330.00
-
EUR 3129.00
-
EUR 872.00
-
EUR 420.00
-
EUR 210.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HIST2H3A (Ala2~Ala136)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Chicken Histone Cluster 2, H3a (HIST2H3A). This antibody is labeled with FITC. |
Histone Cluster 2, H3a (HIST2H3A) Polyclonal Antibody (Chicken), HRP |
4-PAQ849Ga01-HRP |
Cloud-Clone |
-
EUR 353.00
-
EUR 3385.00
-
EUR 940.00
-
EUR 451.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HIST2H3A (Ala2~Ala136)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Chicken Histone Cluster 2, H3a (HIST2H3A). This antibody is labeled with HRP. |
Histone Cluster 2, H3a (HIST2H3A) Polyclonal Antibody (Chicken), PE |
4-PAQ849Ga01-PE |
Cloud-Clone |
-
EUR 330.00
-
EUR 3129.00
-
EUR 872.00
-
EUR 420.00
-
EUR 210.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HIST2H3A (Ala2~Ala136)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Chicken Histone Cluster 2, H3a (HIST2H3A). This antibody is labeled with PE. |
Histone Cluster 2, H3a (HIST2H3A) Polyclonal Antibody (Human, Rat), APC |
4-PAQ849Hu01-APC |
Cloud-Clone |
-
EUR 367.00
-
EUR 3581.00
-
EUR 989.00
-
EUR 470.00
-
EUR 228.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HIST2H3A (Met1~Ala136)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Histone Cluster 2, H3a (HIST2H3A). This antibody is labeled with APC. |
Histone Cluster 2, H3a (HIST2H3A) Polyclonal Antibody (Human, Rat), Biotinylated |
4-PAQ849Hu01-Biotin |
Cloud-Clone |
-
EUR 327.00
-
EUR 2684.00
-
EUR 783.00
-
EUR 403.00
-
EUR 225.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HIST2H3A (Met1~Ala136)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Histone Cluster 2, H3a (HIST2H3A). This antibody is labeled with Biotin. |
Histone Cluster 2, H3a (HIST2H3A) Polyclonal Antibody (Human, Rat), Cy3 |
4-PAQ849Hu01-Cy3 |
Cloud-Clone |
-
EUR 447.00
-
EUR 4733.00
-
EUR 1277.00
-
EUR 585.00
-
EUR 263.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HIST2H3A (Met1~Ala136)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Histone Cluster 2, H3a (HIST2H3A). This antibody is labeled with Cy3. |
Histone Cluster 2, H3a (HIST2H3A) Polyclonal Antibody (Human, Rat), FITC |
4-PAQ849Hu01-FITC |
Cloud-Clone |
-
EUR 313.00
-
EUR 2884.00
-
EUR 811.00
-
EUR 396.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HIST2H3A (Met1~Ala136)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Histone Cluster 2, H3a (HIST2H3A). This antibody is labeled with FITC. |
Histone Cluster 2, H3a (HIST2H3A) Polyclonal Antibody (Human, Rat), HRP |
4-PAQ849Hu01-HRP |
Cloud-Clone |
-
EUR 334.00
-
EUR 3120.00
-
EUR 873.00
-
EUR 424.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HIST2H3A (Met1~Ala136)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Histone Cluster 2, H3a (HIST2H3A). This antibody is labeled with HRP. |
Histone Cluster 2, H3a (HIST2H3A) Polyclonal Antibody (Human, Rat), PE |
4-PAQ849Hu01-PE |
Cloud-Clone |
-
EUR 313.00
-
EUR 2884.00
-
EUR 811.00
-
EUR 396.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HIST2H3A (Met1~Ala136)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Histone Cluster 2, H3a (HIST2H3A). This antibody is labeled with PE. |
Histone Cluster 2, H3a (HIST2H3A) Polyclonal Antibody (Chicken), APC-Cy7 |
4-PAQ849Ga01-APC-Cy7 |
Cloud-Clone |
-
EUR 657.00
-
EUR 7654.00
-
EUR 2011.00
-
EUR 882.00
-
EUR 355.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HIST2H3A (Ala2~Ala136)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Chicken Histone Cluster 2, H3a (HIST2H3A). This antibody is labeled with APC-Cy7. |
Histone Cluster 2, H3a (HIST2H3A) Polyclonal Antibody (Human, Rat), APC-Cy7 |
4-PAQ849Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 614.00
-
EUR 7042.00
-
EUR 1858.00
-
EUR 821.00
-
EUR 337.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HIST2H3A (Met1~Ala136)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Histone Cluster 2, H3a (HIST2H3A). This antibody is labeled with APC-Cy7. |
Histone Cluster 2, H3a Antibody |
20-abx129722 |
Abbexa |
-
EUR 467.00
-
EUR 133.00
-
EUR 1344.00
-
EUR 634.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Human Histone Cluster 2, H2be (HIST2H2BE) ELISA Kit |
20-abx585323 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-12 working days.
|
Human Histone Cluster 2, H2be (HIST2H2BE) ELISA Kit |
20-abx585324 |
Abbexa |
-
EUR 7504.00
-
EUR 3996.00
-
EUR 926.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-12 working days.
|
HIST2H3A ELISA Kit (Human) (OKCD01095) |
OKCD01095 |
Aviva Systems Biology |
96 Wells |
EUR 909 |
Description: Description of target: Core component of nucleosome. Nucleosomes wrap and compact DNA into chromatin, limiting DNA accessibility to the cellular machineries which require DNA as a template. Histones thereby play a central role in transcription regulation, DNA repair, DNA replication and chromosomal stability. DNA accessibility is regulated via a complex set of post-translational modifications of histones, also called histone code, and nucleosome remodeling. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.115 ng/mL |
Rat Histone Cluster 2, H2be (HIST2H2BE) ELISA Kit |
20-abx585325 |
Abbexa |
-
EUR 7911.00
-
EUR 4215.00
-
EUR 973.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-12 working days.
|
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
Human Histone Cluster 2, H2be (HIST2H2BE) Protein |
20-abx168051 |
Abbexa |
-
EUR 620.00
-
EUR 272.00
-
EUR 1859.00
-
EUR 732.00
-
EUR 453.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Human Histone Cluster 2, H2aa3 (HIST2H2AA3) Protein |
20-abx067125 |
Abbexa |
-
EUR 690.00
-
EUR 286.00
-
EUR 2110.00
-
EUR 815.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Human Histone Cluster 2, H2ac (HIST2H2AC) Protein |
20-abx067126 |
Abbexa |
-
EUR 662.00
-
EUR 272.00
-
EUR 2040.00
-
EUR 787.00
-
EUR 481.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Human Histone Cluster 1, H1a (HIST1H1A) ELISA Kit |
20-abx156773 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Histone Cluster 1, H2ab (HIST1H2AB) ELISA Kit |
20-abx258163 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Histone Cluster 1, H4a (HIST1H4A) ELISA Kit |
20-abx258903 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Histone Cluster 3, H3 (HIST3H3) ELISA Kit |
20-abx385010 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-12 working days.
|
Human Histone Cluster 1, H4a ELISA Kit (HIST1H4A) |
RK01567 |
Abclonal |
96 Tests |
EUR 521 |
Human Histone Cluster 1, H4a (HIST1H4A) ELISA Kit |
SEQ004Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5189.65 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Histone Cluster 1, H4a (HIST1H4A) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Histone Cluster 1, H4a (HIST1H4A) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Histone Cluster 1, H4a (HIST1H4A) ELISA Kit |
SEQ004Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 515.03 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Histone Cluster 1, H4a (HIST1H4A) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Histone Cluster 1, H4a (HIST1H4A) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Histone Cluster 1, H4a (HIST1H4A) ELISA Kit |
SEQ004Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 692.9 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Histone Cluster 1, H4a (HIST1H4A) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Histone Cluster 1, H4a (HIST1H4A) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Histone Cluster 1, H4a (HIST1H4A) ELISA Kit |
SEQ004Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2818.05 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Histone Cluster 1, H4a (HIST1H4A) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Histone Cluster 1, H4a (HIST1H4A) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Histone Cluster 1, H4a (HIST1H4A) ELISA Kit |
4-SEQ004Hu |
Cloud-Clone |
-
EUR 5240.00
-
EUR 2769.00
-
EUR 693.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Histone Cluster 1, H4a elisa. Alternative names of the recognized antigen: H4FA
- HIST2H4B
- HIST2H4C
- HIST2H4D
- HIST2H4E
- HIST2H4F
- HIST2H4G
- HIST2H4H
- HIST2H4I
- HIST2H4J
- HIST2H4K
- HIST2H4B
- HIST4H4
- HIST2H4A
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Histone Cluster 1, H4a (HIST1H4A) in samples from tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Human Histone Cluster 1, H2ab (HIST1H2AB) ELISA Kit |
SEQ021Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5189.65 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Histone Cluster 1, H2ab (HIST1H2AB) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay:
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Histone Cluster 1, H2ab (HIST1H2AB) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Histone Cluster 1, H2ab (HIST1H2AB) ELISA Kit |
SEQ021Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 515.03 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Histone Cluster 1, H2ab (HIST1H2AB) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay:
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Histone Cluster 1, H2ab (HIST1H2AB) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Histone Cluster 1, H2ab (HIST1H2AB) ELISA Kit |
SEQ021Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 692.9 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Histone Cluster 1, H2ab (HIST1H2AB) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay:
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Histone Cluster 1, H2ab (HIST1H2AB) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Histone Cluster 1, H2ab (HIST1H2AB) ELISA Kit |
SEQ021Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2818.05 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Histone Cluster 1, H2ab (HIST1H2AB) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay:
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Histone Cluster 1, H2ab (HIST1H2AB) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Histone Cluster 1, H2ab (HIST1H2AB) ELISA Kit |
4-SEQ021Hu |
Cloud-Clone |
-
EUR 5240.00
-
EUR 2769.00
-
EUR 693.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Histone Cluster 1, H2ab elisa. Alternative names of the recognized antigen: HIST1H2AE
- H2AFM
- H2A/m
- H2A Histone Family Member M
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Histone Cluster 1, H2ab (HIST1H2AB) in samples from tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Human Histone Cluster 1, H1a (HIST1H1A) ELISA Kit |
SEJ782Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Histone Cluster 1, H1a (HIST1H1A) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Histone Cluster 1, H1a (HIST1H1A) in Tissue homogenates, cell lysates and other biological fluids. |
Human Histone Cluster 1, H1a (HIST1H1A) ELISA Kit |
SEJ782Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Histone Cluster 1, H1a (HIST1H1A) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Histone Cluster 1, H1a (HIST1H1A) in Tissue homogenates, cell lysates and other biological fluids. |
Human Histone Cluster 1, H1a (HIST1H1A) ELISA Kit |
SEJ782Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Histone Cluster 1, H1a (HIST1H1A) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Histone Cluster 1, H1a (HIST1H1A) in Tissue homogenates, cell lysates and other biological fluids. |
Human Histone Cluster 1, H1a (HIST1H1A) ELISA Kit |
SEJ782Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Histone Cluster 1, H1a (HIST1H1A) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Histone Cluster 1, H1a (HIST1H1A) in Tissue homogenates, cell lysates and other biological fluids. |
Human Histone Cluster 1, H1a (HIST1H1A) ELISA Kit |
4-SEJ782Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Histone Cluster 1, H1a elisa. Alternative names of the recognized antigen: n/a
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Histone Cluster 1, H1a (HIST1H1A) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Histone Cluster 2, H2aa3 (HIST2H2AA3) Antibody |
abx027547-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Histone Cluster 2, H2aa3 (HIST2H2AA3) Antibody |
abx027547-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Histone Cluster 2, H2ac (HIST2H2AC) Antibody |
20-abx102878 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1316.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Histone Cluster 2, H2aa3 (HIST2H2AA3) Antibody |
20-abx103153 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1316.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Histone Cluster 2, H2be (HIST2H2BE) Antibody |
20-abx113029 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Histone Cluster 2, H2be (HIST2H2BE) Antibody |
20-abx128664 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1302.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Histone Cluster 2, H2ac (HIST2H2AC) Antibody |
abx031289-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Histone Cluster 2, H2ac (HIST2H2AC) Antibody |
abx031289-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Histone Cluster 2, H2ac (HIST2H2AC) Antibody |
20-abx301208 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Recombinant Histone Cluster 2, H2be (HIST2H2BE) |
4-RPQ006Hu01 |
Cloud-Clone |
-
EUR 440.48
-
EUR 221.00
-
EUR 1376.80
-
EUR 525.60
-
EUR 951.20
-
EUR 358.00
-
EUR 3292.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q16778
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 17.6kDa
- Isoelectric Point: 10.4
|
Description: Recombinant Human Histone Cluster 2, H2be expressed in: E.coli |
Recombinant Histone Cluster 2, H2ac (HIST2H2AC) |
4-RPQ018Hu01 |
Cloud-Clone |
-
EUR 476.32
-
EUR 230.00
-
EUR 1511.20
-
EUR 570.40
-
EUR 1040.80
-
EUR 382.00
-
EUR 3628.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q16777
- Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 44.0kDa
- Isoelectric Point: 10.9
|
Description: Recombinant Human Histone Cluster 2, H2ac expressed in: E.coli |
Recombinant Histone Cluster 2, H2aa3 (HIST2H2AA3) |
4-RPQ019Hu01 |
Cloud-Clone |
-
EUR 490.66
-
EUR 234.00
-
EUR 1564.96
-
EUR 588.32
-
EUR 1076.64
-
EUR 391.00
-
EUR 3762.40
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q6FI13
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 40.9kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Histone Cluster 2, H2aa3 expressed in: E.coli |
Histone Cluster 1, H4a (HIST1H4A) ELISA Kit |
20-abx258202 |
Abbexa |
-
EUR 7504.00
-
EUR 3996.00
-
EUR 926.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Histone Cluster 2, H2be (HIST2H2BE) Polyclonal Antibody (Human) |
4-PAQ006Hu01 |
Cloud-Clone |
-
EUR 261.00
-
EUR 2734.00
-
EUR 676.00
-
EUR 330.00
-
EUR 220.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HIST2H2BE (Pro2~Lys126)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Histone Cluster 2, H2be (HIST2H2BE) |
Histone Cluster 2, H2ac (HIST2H2AC) Polyclonal Antibody (Human) |
4-PAQ018Hu01 |
Cloud-Clone |
-
EUR 262.00
-
EUR 2747.00
-
EUR 679.00
-
EUR 331.00
-
EUR 220.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HIST2H2AC (Met1~Lys129)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Histone Cluster 2, H2ac (HIST2H2AC) |
Histone Cluster 2, H2aa3 (HIST2H2AA3) Polyclonal Antibody (Human) |
4-PAQ019Hu01 |
Cloud-Clone |
-
EUR 262.00
-
EUR 2747.00
-
EUR 679.00
-
EUR 331.00
-
EUR 220.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HIST2H2AA3 (Met1~Lys130)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Histone Cluster 2, H2aa3 (HIST2H2AA3) |
HIST2H3A Antibody |
1-CSB-PA744479HA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against HIST2H3A. Recognizes HIST2H3A from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IF:1:50-1:200 |
HIST2H3A siRNA |
20-abx919520 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ELISA kit for Human HIST1H1A (Histone Cluster 1, H1a) |
ELK5025 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Histone Cluster 1, H1a (HIST1H1A). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to
- Show more
|
Description: A sandwich ELISA kit for detection of Histone Cluster 1, H1a from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Human HIST1H2AB (Histone Cluster 1, H2ab) |
ELK7466 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Histone Cluster 1, H2ab (HIST1H2AB). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific t
- Show more
|
Description: A sandwich ELISA kit for detection of Histone Cluster 1, H2ab from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Human HIST1H4A (Histone Cluster 1, H4a) |
ELK7766 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Histone Cluster 1, H4a (HIST1H4A). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to
- Show more
|
Description: A sandwich ELISA kit for detection of Histone Cluster 1, H4a from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Human HIST1H4A (Histone Cluster 1, H4a) |
ELK8131 |
ELK Biotech |
1 plate of 96 wells |
EUR 372 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Histone Cluster 1, H4a (HIST1H4A). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to
- Show more
|
Description: A sandwich ELISA kit for detection of Histone Cluster 1, H4a from Human,Mouse,Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Histone Cluster 2, H4b (HIST2H4B AcK8) Antibody |
abx412437-01ml |
Abbexa |
0.1 ml |
EUR 801 |
|
Histone Cluster 2, H2aa3 (HIST2H2AA3) Antibody (FITC) |
20-abx271130 |
Abbexa |
-
EUR 509.00
-
EUR 258.00
-
EUR 1539.00
-
EUR 718.00
-
EUR 411.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Histone Cluster 2, H2ac (HIST2H2AC) Antibody (FITC) |
20-abx271131 |
Abbexa |
-
EUR 509.00
-
EUR 258.00
-
EUR 1539.00
-
EUR 718.00
-
EUR 411.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Histone Cluster 2, H2aa3 (HIST2H2AA3) Antibody (Biotin) |
20-abx271396 |
Abbexa |
-
EUR 481.00
-
EUR 244.00
-
EUR 1428.00
-
EUR 676.00
-
EUR 356.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Histone Cluster 2, H2ac (HIST2H2AC) Antibody (Biotin) |
20-abx271397 |
Abbexa |
-
EUR 481.00
-
EUR 244.00
-
EUR 1428.00
-
EUR 676.00
-
EUR 356.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Histone Cluster 2, H2be (HIST2H2BE) Antibody Pair |
20-abx370809 |
Abbexa |
|
-
10 × 96 tests
-
5 × 96 tests
|
- Shipped within 5-15 working days.
|
Histone Cluster 2, H2be (HIST2H2BE) Antibody Pair |
20-abx370816 |
Abbexa |
|
-
10 × 96 tests
-
5 × 96 tests
|
- Shipped within 5-15 working days.
|
Histone Cluster 2, H2be (HIST2H2BE) Antibody Pair |
20-abx370817 |
Abbexa |
|
-
10 × 96 tests
-
5 × 96 tests
|
- Shipped within 5-15 working days.
|
Histone Cluster 2, H2ac (HIST2H2AC) Antibody (HRP) |
20-abx304155 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Histone Cluster 2, H2ac (HIST2H2AC) Antibody (FITC) |
20-abx304156 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Histone Cluster 2, H2ac (HIST2H2AC) Antibody (Biotin) |
20-abx304157 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Cow Histone Cluster 1, H4a (HIST1H4A) ELISA Kit |
20-abx258900 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Mouse Histone Cluster 1, H4a (HIST1H4A) ELISA Kit |
20-abx258901 |
Abbexa |
-
EUR 7645.00
-
EUR 4074.00
-
EUR 942.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Rat Histone Cluster 1, H4a (HIST1H4A) ELISA Kit |
20-abx258902 |
Abbexa |
-
EUR 7504.00
-
EUR 3996.00
-
EUR 926.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Rat Histone Cluster 1, H2ab (HIST1H2AB) ELISA Kit |
20-abx585312 |
Abbexa |
-
EUR 7911.00
-
EUR 4215.00
-
EUR 973.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-12 working days.
|
Mouse Histone Cluster 1, H2ab (HIST1H2AB) ELISA Kit |
20-abx585313 |
Abbexa |
-
EUR 7504.00
-
EUR 3996.00
-
EUR 926.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-12 working days.
|
Mouse Histone Cluster 1, H4a ELISA Kit (HIST1H4A) |
RK02892 |
Abclonal |
96 Tests |
EUR 521 |
Cattle Histone Cluster 1, H4a (HIST1H4A) ELISA Kit |
SEQ004Bo-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5922.69 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Histone Cluster 1, H4a (HIST1H4A) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: C
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Histone Cluster 1, H4a (HIST1H4A) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Cattle Histone Cluster 1, H4a (HIST1H4A) ELISA Kit |
SEQ004Bo-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 575.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Histone Cluster 1, H4a (HIST1H4A) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: C
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Histone Cluster 1, H4a (HIST1H4A) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Cattle Histone Cluster 1, H4a (HIST1H4A) ELISA Kit |
SEQ004Bo-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 779.14 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Histone Cluster 1, H4a (HIST1H4A) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: C
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Histone Cluster 1, H4a (HIST1H4A) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Cattle Histone Cluster 1, H4a (HIST1H4A) ELISA Kit |
SEQ004Bo-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 3206.13 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Histone Cluster 1, H4a (HIST1H4A) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: C
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Histone Cluster 1, H4a (HIST1H4A) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Cattle Histone Cluster 1, H4a (HIST1H4A) ELISA Kit |
4-SEQ004Bo |
Cloud-Clone |
-
EUR 5973.00
-
EUR 3157.00
-
EUR 780.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Histone Cluster 1, H4a elisa. Alternative names of the recognized antigen: H4FA
- HIST2H4B
- HIST2H4C
- HIST2H4D
- HIST2H4E
- HIST2H4F
- HIST2H4G
- HIST2H4H
- HIST2H4I
- HIST2H4J
- HIST2H4K
- HIST2H4B
- HIST4H4
- HIST2H4A
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Cattle Histone Cluster 1, H4a (HIST1H4A) in samples from tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Mouse Histone Cluster 1, H4a (HIST1H4A) ELISA Kit |
SEQ004Mu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5098.02 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Histone Cluster 1, H4a (HIST1H4A) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Histone Cluster 1, H4a (HIST1H4A) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Mouse Histone Cluster 1, H4a (HIST1H4A) ELISA Kit |
SEQ004Mu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 507.48 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Histone Cluster 1, H4a (HIST1H4A) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Histone Cluster 1, H4a (HIST1H4A) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Mouse Histone Cluster 1, H4a (HIST1H4A) ELISA Kit |
SEQ004Mu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 682.12 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Histone Cluster 1, H4a (HIST1H4A) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Histone Cluster 1, H4a (HIST1H4A) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Mouse Histone Cluster 1, H4a (HIST1H4A) ELISA Kit |
SEQ004Mu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2769.54 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Histone Cluster 1, H4a (HIST1H4A) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Histone Cluster 1, H4a (HIST1H4A) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Mouse Histone Cluster 1, H4a (HIST1H4A) ELISA Kit |
4-SEQ004Mu |
Cloud-Clone |
-
EUR 5149.00
-
EUR 2720.00
-
EUR 683.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Histone Cluster 1, H4a elisa. Alternative names of the recognized antigen: H4FA
- HIST2H4B
- HIST2H4C
- HIST2H4D
- HIST2H4E
- HIST2H4F
- HIST2H4G
- HIST2H4H
- HIST2H4I
- HIST2H4J
- HIST2H4K
- HIST2H4B
- HIST4H4
- HIST2H4A
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Histone Cluster 1, H4a (HIST1H4A) in samples from tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Rat Histone Cluster 1, H4a (HIST1H4A) ELISA Kit |
SEQ004Ra-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5372.91 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Histone Cluster 1, H4a (HIST1H4A) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<1
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Histone Cluster 1, H4a (HIST1H4A) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Rat Histone Cluster 1, H4a (HIST1H4A) ELISA Kit |
SEQ004Ra-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 530.12 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Histone Cluster 1, H4a (HIST1H4A) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<1
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Histone Cluster 1, H4a (HIST1H4A) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Rat Histone Cluster 1, H4a (HIST1H4A) ELISA Kit |
SEQ004Ra-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 714.46 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Histone Cluster 1, H4a (HIST1H4A) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<1
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Histone Cluster 1, H4a (HIST1H4A) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Rat Histone Cluster 1, H4a (HIST1H4A) ELISA Kit |
SEQ004Ra-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2915.07 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Histone Cluster 1, H4a (HIST1H4A) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<1
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Histone Cluster 1, H4a (HIST1H4A) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Rat Histone Cluster 1, H4a (HIST1H4A) ELISA Kit |
4-SEQ004Ra |
Cloud-Clone |
-
EUR 5423.00
-
EUR 2866.00
-
EUR 715.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Histone Cluster 1, H4a elisa. Alternative names of the recognized antigen: H4FA
- HIST2H4B
- HIST2H4C
- HIST2H4D
- HIST2H4E
- HIST2H4F
- HIST2H4G
- HIST2H4H
- HIST2H4I
- HIST2H4J
- HIST2H4K
- HIST2H4B
- HIST4H4
- HIST2H4A
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Histone Cluster 1, H4a (HIST1H4A) in samples from tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Human HIST2H3A shRNA Plasmid |
20-abx967204 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
HIST2H3A sgRNA CRISPR Lentivector (Human) (Target 2) |
K0961203 |
ABM |
1.0 ug DNA |
EUR 154 |
Histone Cluster 2, H2be (HIST2H2BE) Polyclonal Antibody (Human), APC |
4-PAQ006Hu01-APC |
Cloud-Clone |
-
EUR 367.00
-
EUR 3581.00
-
EUR 989.00
-
EUR 470.00
-
EUR 228.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HIST2H2BE (Pro2~Lys126)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Histone Cluster 2, H2be (HIST2H2BE). This antibody is labeled with APC. |
Histone Cluster 2, H2be (HIST2H2BE) Polyclonal Antibody (Human), Biotinylated |
4-PAQ006Hu01-Biotin |
Cloud-Clone |
-
EUR 327.00
-
EUR 2684.00
-
EUR 783.00
-
EUR 403.00
-
EUR 225.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HIST2H2BE (Pro2~Lys126)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Histone Cluster 2, H2be (HIST2H2BE). This antibody is labeled with Biotin. |
Histone Cluster 2, H2be (HIST2H2BE) Polyclonal Antibody (Human), Cy3 |
4-PAQ006Hu01-Cy3 |
Cloud-Clone |
-
EUR 447.00
-
EUR 4733.00
-
EUR 1277.00
-
EUR 585.00
-
EUR 263.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HIST2H2BE (Pro2~Lys126)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Histone Cluster 2, H2be (HIST2H2BE). This antibody is labeled with Cy3. |
Histone Cluster 2, H2be (HIST2H2BE) Polyclonal Antibody (Human), FITC |
4-PAQ006Hu01-FITC |
Cloud-Clone |
-
EUR 313.00
-
EUR 2884.00
-
EUR 811.00
-
EUR 396.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HIST2H2BE (Pro2~Lys126)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Histone Cluster 2, H2be (HIST2H2BE). This antibody is labeled with FITC. |
Histone Cluster 2, H2be (HIST2H2BE) Polyclonal Antibody (Human), HRP |
4-PAQ006Hu01-HRP |
Cloud-Clone |
-
EUR 334.00
-
EUR 3120.00
-
EUR 873.00
-
EUR 424.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HIST2H2BE (Pro2~Lys126)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Histone Cluster 2, H2be (HIST2H2BE). This antibody is labeled with HRP. |
Histone Cluster 2, H2be (HIST2H2BE) Polyclonal Antibody (Human), PE |
4-PAQ006Hu01-PE |
Cloud-Clone |
-
EUR 313.00
-
EUR 2884.00
-
EUR 811.00
-
EUR 396.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HIST2H2BE (Pro2~Lys126)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Histone Cluster 2, H2be (HIST2H2BE). This antibody is labeled with PE. |
Histone Cluster 2, H2ac (HIST2H2AC) Polyclonal Antibody (Human), APC |
4-PAQ018Hu01-APC |
Cloud-Clone |
-
EUR 368.00
-
EUR 3599.00
-
EUR 993.00
-
EUR 472.00
-
EUR 229.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HIST2H2AC (Met1~Lys129)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Histone Cluster 2, H2ac (HIST2H2AC). This antibody is labeled with APC. |
Histone Cluster 2, H2ac (HIST2H2AC) Polyclonal Antibody (Human), Biotinylated |
4-PAQ018Hu01-Biotin |
Cloud-Clone |
-
EUR 328.00
-
EUR 2697.00
-
EUR 786.00
-
EUR 404.00
-
EUR 226.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HIST2H2AC (Met1~Lys129)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Histone Cluster 2, H2ac (HIST2H2AC). This antibody is labeled with Biotin. |
Histone Cluster 2, H2ac (HIST2H2AC) Polyclonal Antibody (Human), Cy3 |
4-PAQ018Hu01-Cy3 |
Cloud-Clone |
-
EUR 449.00
-
EUR 4757.00
-
EUR 1283.00
-
EUR 588.00
-
EUR 264.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HIST2H2AC (Met1~Lys129)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Histone Cluster 2, H2ac (HIST2H2AC). This antibody is labeled with Cy3. |
Histone Cluster 2, H2ac (HIST2H2AC) Polyclonal Antibody (Human), FITC |
4-PAQ018Hu01-FITC |
Cloud-Clone |
-
EUR 314.00
-
EUR 2899.00
-
EUR 814.00
-
EUR 397.00
-
EUR 203.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HIST2H2AC (Met1~Lys129)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Histone Cluster 2, H2ac (HIST2H2AC). This antibody is labeled with FITC. |
Histone Cluster 2, H2ac (HIST2H2AC) Polyclonal Antibody (Human), HRP |
4-PAQ018Hu01-HRP |
Cloud-Clone |
-
EUR 335.00
-
EUR 3135.00
-
EUR 877.00
-
EUR 426.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HIST2H2AC (Met1~Lys129)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Histone Cluster 2, H2ac (HIST2H2AC). This antibody is labeled with HRP. |
Histone Cluster 2, H2ac (HIST2H2AC) Polyclonal Antibody (Human), PE |
4-PAQ018Hu01-PE |
Cloud-Clone |
-
EUR 314.00
-
EUR 2899.00
-
EUR 814.00
-
EUR 397.00
-
EUR 203.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HIST2H2AC (Met1~Lys129)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Histone Cluster 2, H2ac (HIST2H2AC). This antibody is labeled with PE. |
Histone Cluster 2, H2aa3 (HIST2H2AA3) Polyclonal Antibody (Human), APC |
4-PAQ019Hu01-APC |
Cloud-Clone |
-
EUR 368.00
-
EUR 3599.00
-
EUR 993.00
-
EUR 472.00
-
EUR 229.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HIST2H2AA3 (Met1~Lys130)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Histone Cluster 2, H2aa3 (HIST2H2AA3). This antibody is labeled with APC. |
Histone Cluster 2, H2aa3 (HIST2H2AA3) Polyclonal Antibody (Human), Biotinylated |
4-PAQ019Hu01-Biotin |
Cloud-Clone |
-
EUR 328.00
-
EUR 2697.00
-
EUR 786.00
-
EUR 404.00
-
EUR 226.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HIST2H2AA3 (Met1~Lys130)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Histone Cluster 2, H2aa3 (HIST2H2AA3). This antibody is labeled with Biotin. |
Histone Cluster 2, H2aa3 (HIST2H2AA3) Polyclonal Antibody (Human), Cy3 |
4-PAQ019Hu01-Cy3 |
Cloud-Clone |
-
EUR 449.00
-
EUR 4757.00
-
EUR 1283.00
-
EUR 588.00
-
EUR 264.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HIST2H2AA3 (Met1~Lys130)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Histone Cluster 2, H2aa3 (HIST2H2AA3). This antibody is labeled with Cy3. |
Histone Cluster 2, H2aa3 (HIST2H2AA3) Polyclonal Antibody (Human), FITC |
4-PAQ019Hu01-FITC |
Cloud-Clone |
-
EUR 314.00
-
EUR 2899.00
-
EUR 814.00
-
EUR 397.00
-
EUR 203.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HIST2H2AA3 (Met1~Lys130)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Histone Cluster 2, H2aa3 (HIST2H2AA3). This antibody is labeled with FITC. |
Histone Cluster 2, H2aa3 (HIST2H2AA3) Polyclonal Antibody (Human), HRP |
4-PAQ019Hu01-HRP |
Cloud-Clone |
-
EUR 335.00
-
EUR 3135.00
-
EUR 877.00
-
EUR 426.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HIST2H2AA3 (Met1~Lys130)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Histone Cluster 2, H2aa3 (HIST2H2AA3). This antibody is labeled with HRP. |
Histone Cluster 2, H2aa3 (HIST2H2AA3) Polyclonal Antibody (Human), PE |
4-PAQ019Hu01-PE |
Cloud-Clone |
-
EUR 314.00
-
EUR 2899.00
-
EUR 814.00
-
EUR 397.00
-
EUR 203.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HIST2H2AA3 (Met1~Lys130)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Histone Cluster 2, H2aa3 (HIST2H2AA3). This antibody is labeled with PE. |
Human Histone Cluster 1, H1a (HIST1H1A) CLIA Kit |
20-abx495780 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Human Histone Cluster 1, H2ab (HIST1H2AB) CLIA Kit |
20-abx496151 |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Human Histone Cluster 1, H4a (HIST1H4A) CLIA Kit |
20-abx496541 |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
HIST2H3A cloning plasmid |
CSB-CL744479HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 411
- Sequence: atggcccgtactaagcagactgctcgcaagtcgaccggcggcaaggccccgaggaagcagctggccaccaaggcggcccgcaagagcgcgccggccacgggcggggtgaagaagccgcaccgctaccggcccggcaccgtagccctgcgggagatccggcgctaccagaagtccac
- Show more
|
Description: A cloning plasmid for the HIST2H3A gene. |
HIST2H3A Rabbit pAb |
A9249-100ul |
Abclonal |
100 ul |
EUR 308 |
HIST2H3A Rabbit pAb |
A9249-200ul |
Abclonal |
200 ul |
EUR 459 |
HIST2H3A Rabbit pAb |
A9249-20ul |
Abclonal |
20 ul |
Ask for price |
HIST2H3A Rabbit pAb |
A9249-50ul |
Abclonal |
50 ul |
Ask for price |
Anti-HIST2H3A antibody |
STJ111627 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. This structure consists of approximately 146 bp of DNA wrapped around a nucleosome, an octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H3 family. Transcripts from this gene lack polyA tails; instead, they contain a palindromic termination element. This gene is found in a histone cluster on chromosome 1. This gene is one of four histone genes in the cluster that are duplicated; this record represents the centromeric copy. |
Human Histone Deacetylase 2 ELISA kit |
E01H0235-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Histone Deacetylase 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Histone Deacetylase 2 ELISA kit |
E01H0235-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Histone Deacetylase 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Histone Deacetylase 2 ELISA kit |
E01H0235-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Histone Deacetylase 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Histone Cluster 1, H1C Antibody |
20-abx113027 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ELISA kit for Mouse HIST1H4A (Histone Cluster 1, H4a) |
ELK7734 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Histone Cluster 1, H4a (HIST1H4A). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to
- Show more
|
Description: A sandwich ELISA kit for detection of Histone Cluster 1, H4a from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Cattle HIST1H4A (Histone Cluster 1, H4a) |
ELK8251 |
ELK Biotech |
1 plate of 96 wells |
EUR 526 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Histone Cluster 1, H4a (HIST1H4A). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to
- Show more
|
Description: A sandwich ELISA kit for detection of Histone Cluster 1, H4a from Cattle in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Rat HIST1H4A (Histone Cluster 1, H4a) |
ELK8252 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Histone Cluster 1, H4a (HIST1H4A). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to
- Show more
|
Description: A sandwich ELISA kit for detection of Histone Cluster 1, H4a from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Multi-species Histone Cluster 1, H4a (HIST1H4A) ELISA Kit |
SEQ004Mi-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5333.64 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Multi-species Histone Cluster 1, H4a (HIST1H4A) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-A
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Multi-species Histone Cluster 1, H4a (HIST1H4A) in Tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Multi-species Histone Cluster 1, H4a (HIST1H4A) ELISA Kit |
SEQ004Mi-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 526.89 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Multi-species Histone Cluster 1, H4a (HIST1H4A) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-A
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Multi-species Histone Cluster 1, H4a (HIST1H4A) in Tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Multi-species Histone Cluster 1, H4a (HIST1H4A) ELISA Kit |
SEQ004Mi-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 709.84 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Multi-species Histone Cluster 1, H4a (HIST1H4A) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-A
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Multi-species Histone Cluster 1, H4a (HIST1H4A) in Tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Multi-species Histone Cluster 1, H4a (HIST1H4A) ELISA Kit |
SEQ004Mi-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2894.28 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Multi-species Histone Cluster 1, H4a (HIST1H4A) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-A
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Multi-species Histone Cluster 1, H4a (HIST1H4A) in Tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Multi-species Histone Cluster 1, H4a (HIST1H4A) ELISA Kit |
4-SEQ004Mi |
Cloud-Clone |
-
EUR 5384.00
-
EUR 2845.00
-
EUR 710.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Histone Cluster 1, H4a elisa. Alternative names of the recognized antigen: H4FA
- HIST2H4B
- HIST2H4C
- HIST2H4D
- HIST2H4E
- HIST2H4F
- HIST2H4G
- HIST2H4H
- HIST2H4I
- HIST2H4J
- HIST2H4K
- HIST2H4B
- HIST4H4
- HIST2H4A
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Multi-species Histone Cluster 1, H4a (HIST1H4A) in samples from Tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Histone Cluster 1, H4a (HIST1H4A) CLIA Kit |
20-abx496150 |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS |
AP-STR-KIT-2 |
CORNING |
1/pk |
EUR 367 |
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller |
Histone Cluster 2, H2be (HIST2H2BE) Polyclonal Antibody (Human), APC-Cy7 |
4-PAQ006Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 614.00
-
EUR 7042.00
-
EUR 1858.00
-
EUR 821.00
-
EUR 337.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HIST2H2BE (Pro2~Lys126)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Histone Cluster 2, H2be (HIST2H2BE). This antibody is labeled with APC-Cy7. |
Histone Cluster 2, H2ac (HIST2H2AC) Polyclonal Antibody (Human), APC-Cy7 |
4-PAQ018Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 616.00
-
EUR 7078.00
-
EUR 1867.00
-
EUR 824.00
-
EUR 338.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HIST2H2AC (Met1~Lys129)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Histone Cluster 2, H2ac (HIST2H2AC). This antibody is labeled with APC-Cy7. |
Histone Cluster 2, H2aa3 (HIST2H2AA3) Polyclonal Antibody (Human), APC-Cy7 |
4-PAQ019Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 616.00
-
EUR 7078.00
-
EUR 1867.00
-
EUR 824.00
-
EUR 338.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HIST2H2AA3 (Met1~Lys130)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Histone Cluster 2, H2aa3 (HIST2H2AA3). This antibody is labeled with APC-Cy7. |
Anti-Histone H3 Antibody |
A12477-2 |
BosterBio |
100ug/vial |
EUR 294 |
HIST2H3A ORF Vector (Human) (pORF) |
ORF020778 |
ABM |
1.0 ug DNA |
EUR 405 |
Human Histone Cluster 1, H2aa (HIST1H2AA) Protein |
20-abx067117 |
Abbexa |
-
EUR 676.00
-
EUR 286.00
-
EUR 2082.00
-
EUR 801.00
-
EUR 481.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Human Histone Cluster 1, H2ab (HIST1H2AB) Protein |
20-abx067118 |
Abbexa |
-
EUR 662.00
-
EUR 272.00
-
EUR 2026.00
-
EUR 787.00
-
EUR 481.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Human Histone Cluster 1, H2ac (HIST1H2AC) Protein |
20-abx067119 |
Abbexa |
-
EUR 676.00
-
EUR 286.00
-
EUR 2082.00
-
EUR 801.00
-
EUR 481.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Human Histone Cluster 1, H2ad (HIST1H2AD) Protein |
20-abx067120 |
Abbexa |
-
EUR 648.00
-
EUR 272.00
-
EUR 1998.00
-
EUR 773.00
-
EUR 467.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Human Histone Cluster 1, H2ag (HIST1H2AG) Protein |
20-abx067121 |
Abbexa |
-
EUR 648.00
-
EUR 272.00
-
EUR 1998.00
-
EUR 773.00
-
EUR 467.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Human Histone Cluster 1, H2ah (HIST1H2AH) Protein |
20-abx067122 |
Abbexa |
-
EUR 676.00
-
EUR 286.00
-
EUR 2082.00
-
EUR 801.00
-
EUR 481.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Human Histone Cluster 1, H2aj (HIST1H2AJ) Protein |
20-abx067123 |
Abbexa |
-
EUR 690.00
-
EUR 286.00
-
EUR 2110.00
-
EUR 815.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Human Histone Cluster 3, H2a (HIST3H2A) Protein |
20-abx067128 |
Abbexa |
-
EUR 690.00
-
EUR 286.00
-
EUR 2110.00
-
EUR 815.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Human Histone Cluster 1, H1a (HIST1H1A) Protein |
20-abx653759 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Histone Cluster 2, H4b Acetyl-Lys12 (HIST2H4B AcK12) Antibody |
abx412195-01ml |
|