Mouse TPM3(Tropomyosin 3) ELISA Kit

Mouse TPM3(Tropomyosin 3) ELISA Kit

To Order Contact us: [email protected]

Human Tropomyosin 3 (TPM3) ELISA Kit

RD-TPM3-Hu-48Tests 48 Tests
EUR 521

Human Tropomyosin 3 (TPM3) ELISA Kit

RD-TPM3-Hu-96Tests 96 Tests
EUR 723

Mouse Tropomyosin 3 (TPM3) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Tropomyosin 3 (TPM3) ELISA Kit

SED449Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Tropomyosin 3 (TPM3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Tropomyosin 3 (TPM3) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Tropomyosin 3 (TPM3) ELISA Kit

SED449Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Tropomyosin 3 (TPM3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Tropomyosin 3 (TPM3) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Tropomyosin 3 (TPM3) ELISA Kit

SED449Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Tropomyosin 3 (TPM3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Tropomyosin 3 (TPM3) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Tropomyosin 3 (TPM3) ELISA Kit

SED449Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Tropomyosin 3 (TPM3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Tropomyosin 3 (TPM3) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Tropomyosin 3 (TPM3) ELISA Kit

  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Tropomyosin 3 elisa. Alternative names of the recognized antigen: NEM1
  • TRK
  • OK/SW-cl.5
  • TM-5
  • TM3
  • TM30
  • TM30nm
  • TPMsk3
  • Hscp30
  • Gamma-tropomyosin
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Tropomyosin 3 (TPM3) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

ELISA kit for Mouse TPM3 (Tropomyosin 3)

ELK7410 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Tropomyosin 3 (TPM3). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Tropomyosin 3
  • Show more
Description: A sandwich ELISA kit for detection of Tropomyosin 3 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Mouse Tropomyosin 3 (TPM3) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Tropomyosin 3 (TPM3) Protein

  • EUR 676.00
  • EUR 286.00
  • EUR 2082.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Tropomyosin 3 (TPM3) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Tropomyosin 3 (TPM3) ELISA Kit

SED449Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tropomyosin 3 (TPM3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tropomyosin 3 (TPM3) in serum, plasma, tissue homogenates and other biological fluids.

Human Tropomyosin 3 (TPM3) ELISA Kit

SED449Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tropomyosin 3 (TPM3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tropomyosin 3 (TPM3) in serum, plasma, tissue homogenates and other biological fluids.

Human Tropomyosin 3 (TPM3) ELISA Kit

SED449Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tropomyosin 3 (TPM3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tropomyosin 3 (TPM3) in serum, plasma, tissue homogenates and other biological fluids.

Human Tropomyosin 3 (TPM3) ELISA Kit

SED449Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tropomyosin 3 (TPM3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tropomyosin 3 (TPM3) in serum, plasma, tissue homogenates and other biological fluids.

Human Tropomyosin 3 (TPM3) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Tropomyosin 3 elisa. Alternative names of the recognized antigen: NEM1
  • TRK
  • OK/SW-cl.5
  • TM-5
  • TM3
  • TM30
  • TM30nm
  • TPMsk3
  • Hscp30
  • Gamma-tropomyosin
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Tropomyosin 3 (TPM3) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Tropomyosin 3 (TPM3) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tropomyosin 3 (TPM3) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Tropomyosin 3 (TPM3) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Tropomyosin 3 (TPM3) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tropomyosin 3 (TPM3) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Recombinant Tropomyosin 3 (TPM3)

  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P06753
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 36.7kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Tropomyosin 3 expressed in: E.coli

Recombinant Tropomyosin 3 (TPM3)

  • EUR 485.28
  • EUR 233.00
  • EUR 1544.80
  • EUR 581.60
  • EUR 1063.20
  • EUR 388.00
  • EUR 3712.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P21107
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 32.3kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Tropomyosin 3 expressed in: E.coli

Recombinant Tropomyosin 3 (TPM3)

  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q63610
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 32.6kDa
  • Isoelectric Point: 4.4
Description: Recombinant Rat Tropomyosin 3 expressed in: E.coli

Mouse Tropomyosin alpha- 3 chain, Tpm3 ELISA KIT

ELI-51846m 96 Tests
EUR 865

Tropomyosin 3 (TPM3) Polyclonal Antibody (Mouse)

  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPM3 (Thr6~Met248)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tropomyosin 3 (TPM3)

ELISA kit for Human TPM3 (Tropomyosin 3)

ELK4088 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Tropomyosin 3 (TPM3). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Tropomyosin 3
  • Show more
Description: A sandwich ELISA kit for detection of Tropomyosin 3 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Tropomyosin 3 (TPM3) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Tropomyosin 3 (TPM3) Protein

  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

ELISA kit for Mouse Tropomyosin alpha-3 chain (TPM3)

KTE70066-48T 48T
EUR 332
  • Tropomyosin alpha-3 chain is a member of the tropomyosin family of actin-binding proteins involved in the contractile system of striated and smooth muscles and the cytoskeleton of non-muscle cells. Tropomyosins are dimers of coiled-coil proteins that
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Tropomyosin alpha-3 chain (TPM3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Tropomyosin alpha-3 chain (TPM3)

KTE70066-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Tropomyosin alpha-3 chain is a member of the tropomyosin family of actin-binding proteins involved in the contractile system of striated and smooth muscles and the cytoskeleton of non-muscle cells. Tropomyosins are dimers of coiled-coil proteins that
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Tropomyosin alpha-3 chain (TPM3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Tropomyosin alpha-3 chain (TPM3)

KTE70066-96T 96T
EUR 539
  • Tropomyosin alpha-3 chain is a member of the tropomyosin family of actin-binding proteins involved in the contractile system of striated and smooth muscles and the cytoskeleton of non-muscle cells. Tropomyosins are dimers of coiled-coil proteins that
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Tropomyosin alpha-3 chain (TPM3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Bovine Tropomyosin alpha- 3 chain, TPM3 ELISA KIT

ELI-28999b 96 Tests
EUR 928

Porcine Tropomyosin alpha- 3 chain, TPM3 ELISA KIT

ELI-51131p 96 Tests
EUR 928

Human Tropomyosin alpha- 3 chain, TPM3 ELISA KIT

ELI-45589h 96 Tests
EUR 824

Tropomyosin 3 (TPM3) Polyclonal Antibody (Mouse), APC

  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPM3 (Thr6~Met248)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tropomyosin 3 (TPM3). This antibody is labeled with APC.

Tropomyosin 3 (TPM3) Polyclonal Antibody (Mouse), Biotinylated

  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPM3 (Thr6~Met248)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tropomyosin 3 (TPM3). This antibody is labeled with Biotin.

Tropomyosin 3 (TPM3) Polyclonal Antibody (Mouse), Cy3

  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPM3 (Thr6~Met248)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tropomyosin 3 (TPM3). This antibody is labeled with Cy3.

Tropomyosin 3 (TPM3) Polyclonal Antibody (Mouse), FITC

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPM3 (Thr6~Met248)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tropomyosin 3 (TPM3). This antibody is labeled with FITC.

Tropomyosin 3 (TPM3) Polyclonal Antibody (Mouse), HRP

  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPM3 (Thr6~Met248)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tropomyosin 3 (TPM3). This antibody is labeled with HRP.

Tropomyosin 3 (TPM3) Polyclonal Antibody (Mouse), PE

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPM3 (Thr6~Met248)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tropomyosin 3 (TPM3). This antibody is labeled with PE.

Human Tropomyosin alpha-3 chain (TPM3)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 59.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Tropomyosin alpha-3 chain(TPM3) expressed in E.coli

Tropomyosin Alpha-3 Chain (TPM3) Antibody

abx238890-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Tropomyosin Alpha-3 Chain (TPM3) Antibody

abx238891-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Tropomyosin Alpha-3 Chain (TPM3) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tropomyosin Alpha-3 Chain (TPM3) Protein

  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

Tropomyosin Alpha-3 Chain (TPM3) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tropomyosin 3 (TPM3) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPM3 (Met1~Ile285)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tropomyosin 3 (TPM3)

TPM3 Tropomyosin-3 Human Recombinant Protein

PROTP06753 Regular: 10ug
EUR 317
Description: TPM3 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 272 amino acids (1-248 a.a.) and having a molecular mass of 31.6kDa. ;TPM3 is fused to a 24 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

ELISA kit for Human Tropomyosin alpha-3 chain (TPM3)

KTE60149-48T 48T
EUR 332
  • Tropomyosin alpha-3 chain is a member of the tropomyosin family of actin-binding proteins involved in the contractile system of striated and smooth muscles and the cytoskeleton of non-muscle cells. Tropomyosins are dimers of coiled-coil proteins that
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Tropomyosin alpha-3 chain (TPM3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Tropomyosin alpha-3 chain (TPM3)

KTE60149-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Tropomyosin alpha-3 chain is a member of the tropomyosin family of actin-binding proteins involved in the contractile system of striated and smooth muscles and the cytoskeleton of non-muscle cells. Tropomyosins are dimers of coiled-coil proteins that
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Tropomyosin alpha-3 chain (TPM3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Tropomyosin alpha-3 chain (TPM3)

KTE60149-96T 96T
EUR 539
  • Tropomyosin alpha-3 chain is a member of the tropomyosin family of actin-binding proteins involved in the contractile system of striated and smooth muscles and the cytoskeleton of non-muscle cells. Tropomyosins are dimers of coiled-coil proteins that
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Tropomyosin alpha-3 chain (TPM3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Tropomyosin 3 (TPM3) Polyclonal Antibody (Mouse), APC-Cy7

  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPM3 (Thr6~Met248)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tropomyosin 3 (TPM3). This antibody is labeled with APC-Cy7.

Recombinant Human Tropomyosin α-3 Chain/TPM3

CF21-10ug 10ug
EUR 156
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Recombinant Human Tropomyosin α-3 Chain/TPM3

CF21-1mg 1mg
EUR 2486
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Recombinant Human Tropomyosin α-3 Chain/TPM3

CF21-500ug 500ug
EUR 1755
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Recombinant Human Tropomyosin α-3 Chain/TPM3

CF21-50ug 50ug
EUR 369
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Tropomyosin Alpha-3 Chain (TPM3) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tropomyosin Alpha-3 Chain (TPM3) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tropomyosin Alpha-3 Chain (TPM3) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tropomyosin 3 (TPM3) Polyclonal Antibody (Human), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPM3 (Met1~Ile285)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tropomyosin 3 (TPM3). This antibody is labeled with APC.

Tropomyosin 3 (TPM3) Polyclonal Antibody (Human), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPM3 (Met1~Ile285)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tropomyosin 3 (TPM3). This antibody is labeled with Biotin.

Tropomyosin 3 (TPM3) Polyclonal Antibody (Human), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPM3 (Met1~Ile285)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tropomyosin 3 (TPM3). This antibody is labeled with Cy3.

Tropomyosin 3 (TPM3) Polyclonal Antibody (Human), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPM3 (Met1~Ile285)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tropomyosin 3 (TPM3). This antibody is labeled with FITC.

Tropomyosin 3 (TPM3) Polyclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPM3 (Met1~Ile285)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tropomyosin 3 (TPM3). This antibody is labeled with HRP.

Tropomyosin 3 (TPM3) Polyclonal Antibody (Human), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPM3 (Met1~Ile285)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tropomyosin 3 (TPM3). This antibody is labeled with PE.

Tropomyosin 3 (TPM3) Polyclonal Antibody (Human), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPM3 (Met1~Ile285)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tropomyosin 3 (TPM3). This antibody is labeled with APC-Cy7.

Tpm3/ Rat Tpm3 ELISA Kit

ELI-40074r 96 Tests
EUR 886

TPM3 ELISA Kit (Mouse) (OKCD00390)

OKCD00390 96 Wells
EUR 857
Description: Description of target: Binds to actin filaments in muscle and non-muscle cells. Plays a central role, in association with the troponin complex, in the calcium dependent regulation of vertebrate striated muscle contraction. Smooth muscle contraction is regulated by interaction with caldesmon. In non-muscle cells is implicated in stabilizing cytoskeleton actin filaments. ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.054 ng/mL


EF003760 96 Tests
EUR 689

Mouse Tropomyosin isoform 5 ELISA kit

E03T0064-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Tropomyosin isoform 5 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Tropomyosin isoform 5 ELISA kit

E03T0064-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Tropomyosin isoform 5 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Tropomyosin isoform 5 ELISA kit

E03T0064-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Tropomyosin isoform 5 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Tropomyosin 3 antibody

70R-4890 50 ug
EUR 467
Description: Rabbit polyclonal Tropomyosin 3 antibody raised against the middle region of TPM3

anti-Tropomyosin 3

YF-PA24885 50 ul
EUR 334
Description: Mouse polyclonal to Tropomyosin 3

TPM3 ELISA Kit (Human) (OKCD00907)

OKCD00907 96 Wells
EUR 831
Description: Description of target: Binds to actin filaments in muscle and non-muscle cells. Plays a central role, in association with the troponin complex, in the calcium dependent regulation of vertebrate striated muscle contraction. Smooth muscle contraction is regulated by interaction with caldesmon. In non-muscle cells is implicated in stabilizing cytoskeleton actin filaments. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.113 ng/mL

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

Mouse Tropomyosin 2 Beta (TPM2) ELISA Kit

DLR-TPM2-Mu-48T 48T
EUR 527
  • Should the Mouse Tropomyosin 2 Beta (TPM2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Tropomyosin 2 Beta (TPM2) in samples from tissue homogenates or other biological fluids.

Mouse Tropomyosin 2 Beta (TPM2) ELISA Kit

DLR-TPM2-Mu-96T 96T
EUR 688
  • Should the Mouse Tropomyosin 2 Beta (TPM2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Tropomyosin 2 Beta (TPM2) in samples from tissue homogenates or other biological fluids.

Mouse Tropomyosin β chain(TPM2) ELISA kit

E03T0729-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Tropomyosin β chain(TPM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Tropomyosin β chain(TPM2) ELISA kit

E03T0729-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Tropomyosin β chain(TPM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Tropomyosin β chain(TPM2) ELISA kit

E03T0729-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Tropomyosin β chain(TPM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Tropomyosin beta chain, Tpm2 ELISA KIT

ELI-39920m 96 Tests
EUR 865

Mouse Tropomyosin 2 Beta (TPM2) ELISA Kit

RDR-TPM2-Mu-48Tests 48 Tests
EUR 557

Mouse Tropomyosin 2 Beta (TPM2) ELISA Kit

RDR-TPM2-Mu-96Tests 96 Tests
EUR 774

Mouse Tropomyosin 2 Beta (TPM2) ELISA Kit

RD-TPM2-Mu-48Tests 48 Tests
EUR 533

Mouse Tropomyosin 2 Beta (TPM2) ELISA Kit

RD-TPM2-Mu-96Tests 96 Tests
EUR 740

Mouse Tropomyosin 2 Beta(TPM2)ELISA kit

QY-E21522 96T
EUR 361

Mouse TPM3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

TPM3 Recombinant Protein (Mouse)

RP180722 100 ug Ask for price

TPM3 Recombinant Protein (Mouse)

RP180725 100 ug Ask for price

TPM3 Recombinant Protein (Mouse)

RP180728 100 ug Ask for price

Tropomyosin 3 Blocking Peptide

33R-9034 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TPM3 antibody, catalog no. 70R-4890

Tpm3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3921304 1.0 ug DNA
EUR 154

TPM3 antibody

70R-20937 50 ul
EUR 435
Description: Rabbit polyclonal TPM3 antibody

TPM3 Antibody

32227-100ul 100ul
EUR 252

TPM3 Antibody

DF6338 200ul
EUR 304
Description: TPM3 Antibody detects endogenous levels of total TPM3.

TPM3 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against TPM3. Recognizes TPM3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

TPM3 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TPM3. Recognizes TPM3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TPM3 Antibody

ABD6338 100 ug
EUR 438

Mouse Tropomyosin Alpha 1 chain(TPM1) ELISA kit

E03T0728-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Tropomyosin Alpha 1 chain(TPM1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Tropomyosin Alpha 1 chain(TPM1) ELISA kit

E03T0728-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Tropomyosin Alpha 1 chain(TPM1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Tropomyosin Alpha 1 chain(TPM1) ELISA kit

E03T0728-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Tropomyosin Alpha 1 chain(TPM1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Tropomyosin Receptor Kinase B (TRKB) ELISA Kit

abx050225-96tests 96 tests
EUR 770
  • Shipped within 5-10 working days.

Mouse Tpm4/ Tropomyosin alpha-4 chain ELISA Kit

E1520Mo 1 Kit
EUR 632

Mouse Tropomyosin alpha- 1 chain, Tpm1 ELISA KIT

ELI-16432m 96 Tests
EUR 865

Mouse Tropomyosin alpha- 4 chain, Tpm4 ELISA KIT

ELI-51847m 96 Tests
EUR 865

Mouse Tropomyosin alpha-4 chain (TPM4) ELISA Kit

abx555580-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Rabbit Tropomyosin isoform 5 ELISA kit

E04T0064-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Tropomyosin isoform 5 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Tropomyosin isoform 5 ELISA kit

E04T0064-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Tropomyosin isoform 5 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Tropomyosin isoform 5 ELISA kit

E04T0064-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Tropomyosin isoform 5 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Tropomyosin isoform 5 ELISA kit

E02T0064-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Tropomyosin isoform 5 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Tropomyosin isoform 5 ELISA kit

E02T0064-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Tropomyosin isoform 5 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Tropomyosin isoform 5 ELISA kit

E02T0064-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Tropomyosin isoform 5 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Tropomyosin isoform 5 ELISA kit

E01T0064-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Tropomyosin isoform 5 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Tropomyosin isoform 5 ELISA kit

E01T0064-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Tropomyosin isoform 5 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Tropomyosin isoform 5 ELISA kit

E01T0064-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Tropomyosin isoform 5 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Tropomyosin isoform 5 ELISA kit

E08T0064-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Tropomyosin isoform 5 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Tropomyosin isoform 5 ELISA kit

E08T0064-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Tropomyosin isoform 5 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Tropomyosin isoform 5 ELISA kit

E08T0064-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Tropomyosin isoform 5 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Tropomyosin isoform 5 ELISA kit

E07T0064-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Tropomyosin isoform 5 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Tropomyosin isoform 5 ELISA kit

E07T0064-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Tropomyosin isoform 5 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Tropomyosin isoform 5 ELISA kit

E07T0064-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Tropomyosin isoform 5 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Tropomyosin isoform 5 ELISA kit

E09T0064-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Tropomyosin isoform 5 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Tropomyosin isoform 5 ELISA kit

E09T0064-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Tropomyosin isoform 5 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Tropomyosin isoform 5 ELISA kit

E09T0064-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Tropomyosin isoform 5 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Tropomyosin isoform 5 ELISA kit

E06T0064-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Tropomyosin isoform 5 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Tropomyosin isoform 5 ELISA kit

E06T0064-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Tropomyosin isoform 5 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Tropomyosin isoform 5 ELISA kit

E06T0064-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Tropomyosin isoform 5 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human TPM4(Tropomyosin-4) ELISA Kit

EH13130 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Tpm3 ORF Vector (Mouse) (pORF)

ORF060242 1.0 ug DNA
EUR 506

Tpm3 ORF Vector (Mouse) (pORF)

ORF060243 1.0 ug DNA
EUR 506

Tpm3 ORF Vector (Mouse) (pORF)

ORF060244 1.0 ug DNA
EUR 506

Tropomyosin protein

30C-CP3034 100 ug
EUR 534
Description: Purified native Human Tropomyosin protein

Tropomyosin protein

30-1227 100 ug
EUR 858
Description: Purified native Human Tropomyosin protein

Tropomyosin antibody

10R-7905 100 ug
EUR 322
Description: Mouse monoclonal Tropomyosin antibody

Tropomyosin antibody

10R-7906 100 ug
EUR 322
Description: Mouse monoclonal Tropomyosin antibody

Tropomyosin antibody

10R-7907 100 ug
EUR 322
Description: Mouse monoclonal Tropomyosin antibody

Tropomyosin Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Tropomyosin. Recognizes Tropomyosin from Charybdis feriata. This antibody is Unconjugated. Tested in the following application: ELISA

Shrimp tropomyosin

AT211 1mg
EUR 1114

Shrimp tropomyosin

AG211 1 mg
EUR 523

TPM3 Rabbit pAb

A13557-100ul 100 ul
EUR 308

TPM3 Rabbit pAb

A13557-200ul 200 ul
EUR 459

TPM3 Rabbit pAb

A13557-20ul 20 ul
EUR 183

TPM3 Rabbit pAb

A13557-50ul 50 ul
EUR 223

TPM3 Rabbit pAb

A1206-100ul 100 ul
EUR 308

TPM3 Rabbit pAb

A1206-200ul 200 ul
EUR 459

TPM3 Rabbit pAb

A1206-20ul 20 ul
EUR 183

TPM3 Rabbit pAb

A1206-50ul 50 ul
EUR 223

Polyclonal TPM3 Antibody

APR03334G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TPM3 . This antibody is tested and proven to work in the following applications:

TPM3 Blocking Peptide

DF6338-BP 1mg
EUR 195

TPM3 Conjugated Antibody

C32227 100ul
EUR 397

TPM3 cloning plasmid

CSB-CL024106HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 858
  • Sequence: atgatggaggccatcaagaaaaagatgcagatgctgaagttagacaaggagaatgctctggatcgggcagagcaagctgaagctgagcagaagcaggcagaagaaagaagtaaacagctggaggatgagctggcagccatgcagaagaagctgaaagggacagaggatgagctgga
  • Show more
Description: A cloning plasmid for the TPM3 gene.

TPM3 cloning plasmid

CSB-CL024106HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 747
  • Sequence: atggctgggatcaccaccatcgaggcggtgaagcgcaagatccaggttctgcagcagcaggcagatgatgcagaggagcgagctgagcgcctccagcgagaagttgagggagaaaggcgggcccgggaacaggctgaggctgaggtggcctccttgaaccgtaggatccagctggt
  • Show more
Description: A cloning plasmid for the TPM3 gene.

TPM3 cloning plasmid

CSB-CL024106HU3-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 477
  • Sequence: atgaaggttattgaaaaccgggccttaaaagatgaagaaaagatggaactccaggaaatccaactcaaagaagctaagcacattgcagaagaggcagataggaagtatgaagaggtggctcgtaagttggtgatcattgaaggagacttggaacgcacagaggaacgagctgagct
  • Show more
Description: A cloning plasmid for the TPM3 gene.

anti- TPM3 antibody

FNab08890 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: tropomyosin 3
  • Uniprot ID: P06753
  • Gene ID: 7170
  • Research Area: Neuroscience, Developmental biology
Description: Antibody raised against TPM3

anti- TPM3 antibody

FNab08891 100µg
EUR 585
  • Immunogen: tropomyosin 3
  • Uniprot ID: P06753
  • Gene ID: 7170
  • Research Area: Neuroscience, Developmental biology
Description: Antibody raised against TPM3

Anti-TPM3 antibody

PAab08890 100 ug
EUR 386

Anti-TPM3 antibody

PAab08891 100 ug
EUR 412


PVT14210 2 ug
EUR 495

Mouse TPM3(Tropomyosin 3) ELISA Kit