Mouse TPM3(Tropomyosin 3) ELISA Kit

Mouse TPM3(Tropomyosin 3) ELISA Kit

To Order Contact us: [email protected]

Human Tropomyosin 3 (TPM3) ELISA Kit
RD-TPM3-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Tropomyosin 3 (TPM3) ELISA Kit
RD-TPM3-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Mouse Tropomyosin 3 (TPM3) ELISA Kit
20-abx258007	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Tropomyosin 3 (TPM3) ELISA Kit
SED449Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4862.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Tropomyosin 3 (TPM3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Tropomyosin 3 (TPM3) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Tropomyosin 3 (TPM3) ELISA Kit
SED449Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 488.08
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Tropomyosin 3 (TPM3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Tropomyosin 3 (TPM3) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Tropomyosin 3 (TPM3) ELISA Kit
SED449Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 654.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Tropomyosin 3 (TPM3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Tropomyosin 3 (TPM3) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Tropomyosin 3 (TPM3) ELISA Kit
SED449Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2644.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Tropomyosin 3 (TPM3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Tropomyosin 3 (TPM3) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Tropomyosin 3 (TPM3) ELISA Kit
4-SED449Mu	Cloud-Clone	EUR 4913.00 EUR 2595.00 EUR 655.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Tropomyosin 3 elisa. Alternative names of the recognized antigen: NEM1 TRK OK/SW-cl.5 TM-5 TM3 TM30 TM30nm TPMsk3 Hscp30 Gamma-tropomyosin
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Tropomyosin 3 (TPM3) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

ELISA kit for Mouse TPM3 (Tropomyosin 3)
ELK7410	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Tropomyosin 3 (TPM3). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Tropomyosin 3 Show more
Description: A sandwich ELISA kit for detection of Tropomyosin 3 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Mouse Tropomyosin 3 (TPM3) CLIA Kit
20-abx494277	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Mouse Tropomyosin 3 (TPM3) Protein
20-abx167283	Abbexa	EUR 676.00 EUR 286.00 EUR 2082.00 EUR 801.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Tropomyosin 3 (TPM3) ELISA Kit
20-abx153391	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Tropomyosin 3 (TPM3) ELISA Kit
SED449Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tropomyosin 3 (TPM3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tropomyosin 3 (TPM3) in serum, plasma, tissue homogenates and other biological fluids.

Human Tropomyosin 3 (TPM3) ELISA Kit
SED449Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tropomyosin 3 (TPM3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tropomyosin 3 (TPM3) in serum, plasma, tissue homogenates and other biological fluids.

Human Tropomyosin 3 (TPM3) ELISA Kit
SED449Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tropomyosin 3 (TPM3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tropomyosin 3 (TPM3) in serum, plasma, tissue homogenates and other biological fluids.

Human Tropomyosin 3 (TPM3) ELISA Kit
SED449Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tropomyosin 3 (TPM3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tropomyosin 3 (TPM3) in serum, plasma, tissue homogenates and other biological fluids.

Human Tropomyosin 3 (TPM3) ELISA Kit
4-SED449Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Tropomyosin 3 elisa. Alternative names of the recognized antigen: NEM1 TRK OK/SW-cl.5 TM-5 TM3 TM30 TM30nm TPMsk3 Hscp30 Gamma-tropomyosin
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Tropomyosin 3 (TPM3) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Tropomyosin 3 (TPM3) Antibody
20-abx116308	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Tropomyosin 3 (TPM3) Antibody
20-abx129193	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Tropomyosin 3 (TPM3) Antibody
20-abx129428	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Tropomyosin 3 (TPM3) Antibody
20-abx141599	Abbexa	EUR 370.00 EUR 606.00 EUR 300.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Tropomyosin 3 (TPM3) Antibody
20-abx174936	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Recombinant Tropomyosin 3 (TPM3)
4-RPD449Hu01	Cloud-Clone	EUR 476.32 EUR 230.00 EUR 1511.20 EUR 570.40 EUR 1040.80 EUR 382.00 EUR 3628.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P06753 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 36.7kDa Isoelectric Point: Inquire
Description: Recombinant Human Tropomyosin 3 expressed in: E.coli

Recombinant Tropomyosin 3 (TPM3)
4-RPD449Mu01	Cloud-Clone	EUR 485.28 EUR 233.00 EUR 1544.80 EUR 581.60 EUR 1063.20 EUR 388.00 EUR 3712.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P21107 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 32.3kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Tropomyosin 3 expressed in: E.coli

Recombinant Tropomyosin 3 (TPM3)
4-RPD449Ra01	Cloud-Clone	EUR 413.60 EUR 214.00 EUR 1276.00 EUR 492.00 EUR 884.00 EUR 340.00 EUR 3040.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q63610 Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 32.6kDa Isoelectric Point: 4.4
Description: Recombinant Rat Tropomyosin 3 expressed in: E.coli

Mouse Tropomyosin alpha- 3 chain, Tpm3 ELISA KIT
ELI-51846m	Lifescience Market	96 Tests	EUR 865

ELISA kit for Human TPM3 (Tropomyosin 3)
ELK4088	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Tropomyosin 3 (TPM3). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Tropomyosin 3 Show more
Description: A sandwich ELISA kit for detection of Tropomyosin 3 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Tropomyosin 3 (TPM3) Polyclonal Antibody (Mouse)
4-PAD449Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TPM3 (Thr6~Met248) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tropomyosin 3 (TPM3)

Human Tropomyosin 3 (TPM3) CLIA Kit
20-abx494276	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Tropomyosin 3 (TPM3) Protein
20-abx166788	Abbexa	EUR 662.00 EUR 272.00 EUR 2040.00 EUR 787.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

ELISA kit for Mouse Tropomyosin alpha-3 chain (TPM3)
KTE70066-48T	Abbkine	48T	EUR 332
Tropomyosin alpha-3 chain is a member of the tropomyosin family of actin-binding proteins involved in the contractile system of striated and smooth muscles and the cytoskeleton of non-muscle cells. Tropomyosins are dimers of coiled-coil proteins that Show more
Description: Quantitative sandwich ELISA for measuring Mouse Tropomyosin alpha-3 chain (TPM3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Tropomyosin alpha-3 chain (TPM3)
KTE70066-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Tropomyosin alpha-3 chain is a member of the tropomyosin family of actin-binding proteins involved in the contractile system of striated and smooth muscles and the cytoskeleton of non-muscle cells. Tropomyosins are dimers of coiled-coil proteins that Show more
Description: Quantitative sandwich ELISA for measuring Mouse Tropomyosin alpha-3 chain (TPM3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Tropomyosin alpha-3 chain (TPM3)
KTE70066-96T	Abbkine	96T	EUR 539
Tropomyosin alpha-3 chain is a member of the tropomyosin family of actin-binding proteins involved in the contractile system of striated and smooth muscles and the cytoskeleton of non-muscle cells. Tropomyosins are dimers of coiled-coil proteins that Show more
Description: Quantitative sandwich ELISA for measuring Mouse Tropomyosin alpha-3 chain (TPM3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Tropomyosin alpha- 3 chain, TPM3 ELISA KIT
ELI-45589h	Lifescience Market	96 Tests	EUR 824

Bovine Tropomyosin alpha- 3 chain, TPM3 ELISA KIT
ELI-28999b	Lifescience Market	96 Tests	EUR 928

Porcine Tropomyosin alpha- 3 chain, TPM3 ELISA KIT
ELI-51131p	Lifescience Market	96 Tests	EUR 928

Tropomyosin 3 (TPM3) Polyclonal Antibody (Mouse), APC
4-PAD449Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TPM3 (Thr6~Met248) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tropomyosin 3 (TPM3). This antibody is labeled with APC.

Tropomyosin 3 (TPM3) Polyclonal Antibody (Mouse), Biotinylated
4-PAD449Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TPM3 (Thr6~Met248) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tropomyosin 3 (TPM3). This antibody is labeled with Biotin.

Tropomyosin 3 (TPM3) Polyclonal Antibody (Mouse), Cy3
4-PAD449Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TPM3 (Thr6~Met248) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tropomyosin 3 (TPM3). This antibody is labeled with Cy3.

Tropomyosin 3 (TPM3) Polyclonal Antibody (Mouse), FITC
4-PAD449Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TPM3 (Thr6~Met248) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tropomyosin 3 (TPM3). This antibody is labeled with FITC.

Tropomyosin 3 (TPM3) Polyclonal Antibody (Mouse), HRP
4-PAD449Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TPM3 (Thr6~Met248) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tropomyosin 3 (TPM3). This antibody is labeled with HRP.

Tropomyosin 3 (TPM3) Polyclonal Antibody (Mouse), PE
4-PAD449Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TPM3 (Thr6~Met248) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tropomyosin 3 (TPM3). This antibody is labeled with PE.

Tropomyosin Alpha-3 Chain (TPM3) Antibody
20-abx001118	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Tropomyosin Alpha-3 Chain (TPM3) Antibody
abx238890-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Tropomyosin Alpha-3 Chain (TPM3) Antibody
abx238891-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Tropomyosin Alpha-3 Chain (TPM3) Antibody
20-abx302281	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Tropomyosin Alpha-3 Chain (TPM3) Protein
20-abx262489	Abbexa	EUR 328.00 EUR 6397.00 EUR 230.00	10 ug 1 mg 2 µg
Shipped within 5-10 working days.

Human Tropomyosin alpha-3 chain (TPM3)
1-CSB-EP024106HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 59.8 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Tropomyosin alpha-3 chain(TPM3) expressed in E.coli

TPM3 Tropomyosin-3 Human Recombinant Protein
PROTP06753	BosterBio	Regular: 10ug	EUR 317
Description: TPM3 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 272 amino acids (1-248 a.a.) and having a molecular mass of 31.6kDa. ;TPM3 is fused to a 24 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Tropomyosin 3 (TPM3) Polyclonal Antibody (Human)
4-PAD449Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TPM3 (Met1~Ile285) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tropomyosin 3 (TPM3)

ELISA kit for Human Tropomyosin alpha-3 chain (TPM3)
KTE60149-48T	Abbkine	48T	EUR 332
Tropomyosin alpha-3 chain is a member of the tropomyosin family of actin-binding proteins involved in the contractile system of striated and smooth muscles and the cytoskeleton of non-muscle cells. Tropomyosins are dimers of coiled-coil proteins that Show more
Description: Quantitative sandwich ELISA for measuring Human Tropomyosin alpha-3 chain (TPM3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Tropomyosin alpha-3 chain (TPM3)
KTE60149-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Tropomyosin alpha-3 chain is a member of the tropomyosin family of actin-binding proteins involved in the contractile system of striated and smooth muscles and the cytoskeleton of non-muscle cells. Tropomyosins are dimers of coiled-coil proteins that Show more
Description: Quantitative sandwich ELISA for measuring Human Tropomyosin alpha-3 chain (TPM3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Tropomyosin alpha-3 chain (TPM3)
KTE60149-96T	Abbkine	96T	EUR 539
Tropomyosin alpha-3 chain is a member of the tropomyosin family of actin-binding proteins involved in the contractile system of striated and smooth muscles and the cytoskeleton of non-muscle cells. Tropomyosins are dimers of coiled-coil proteins that Show more
Description: Quantitative sandwich ELISA for measuring Human Tropomyosin alpha-3 chain (TPM3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Tropomyosin 3 (TPM3) Polyclonal Antibody (Mouse), APC-Cy7
4-PAD449Mu01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TPM3 (Thr6~Met248) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tropomyosin 3 (TPM3). This antibody is labeled with APC-Cy7.

Tropomyosin Alpha-3 Chain (TPM3) Antibody (HRP)
20-abx316059	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Tropomyosin Alpha-3 Chain (TPM3) Antibody (FITC)
20-abx316060	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Tropomyosin Alpha-3 Chain (TPM3) Antibody (Biotin)
20-abx316061	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Recombinant Human Tropomyosin α-3 Chain/TPM3
CF21-10ug	Novoprotein	10ug	EUR 156
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Recombinant Human Tropomyosin α-3 Chain/TPM3
CF21-1mg	Novoprotein	1mg	EUR 2486
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Recombinant Human Tropomyosin α-3 Chain/TPM3
CF21-500ug	Novoprotein	500ug	EUR 1755
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Recombinant Human Tropomyosin α-3 Chain/TPM3
CF21-50ug	Novoprotein	50ug	EUR 369
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Tropomyosin 3 (TPM3) Polyclonal Antibody (Human), APC
4-PAD449Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TPM3 (Met1~Ile285) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tropomyosin 3 (TPM3). This antibody is labeled with APC.

Tropomyosin 3 (TPM3) Polyclonal Antibody (Human), Biotinylated
4-PAD449Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TPM3 (Met1~Ile285) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tropomyosin 3 (TPM3). This antibody is labeled with Biotin.

Tropomyosin 3 (TPM3) Polyclonal Antibody (Human), Cy3
4-PAD449Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TPM3 (Met1~Ile285) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tropomyosin 3 (TPM3). This antibody is labeled with Cy3.

Tropomyosin 3 (TPM3) Polyclonal Antibody (Human), FITC
4-PAD449Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TPM3 (Met1~Ile285) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tropomyosin 3 (TPM3). This antibody is labeled with FITC.

Tropomyosin 3 (TPM3) Polyclonal Antibody (Human), HRP
4-PAD449Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TPM3 (Met1~Ile285) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tropomyosin 3 (TPM3). This antibody is labeled with HRP.

Tropomyosin 3 (TPM3) Polyclonal Antibody (Human), PE
4-PAD449Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TPM3 (Met1~Ile285) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tropomyosin 3 (TPM3). This antibody is labeled with PE.

Tropomyosin 3 (TPM3) Polyclonal Antibody (Human), APC-Cy7
4-PAD449Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TPM3 (Met1~Ile285) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tropomyosin 3 (TPM3). This antibody is labeled with APC-Cy7.

Tpm3/ Rat Tpm3 ELISA Kit
ELI-40074r	Lifescience Market	96 Tests	EUR 886

TPM3 ELISA KIT\|Human
EF003760	Lifescience Market	96 Tests	EUR 689

Mouse Tropomyosin isoform 5 ELISA kit
E03T0064-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Tropomyosin isoform 5 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Tropomyosin isoform 5 ELISA kit
E03T0064-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Tropomyosin isoform 5 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Tropomyosin isoform 5 ELISA kit
E03T0064-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Tropomyosin isoform 5 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Tropomyosin 3 antibody
70R-4890	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal Tropomyosin 3 antibody raised against the middle region of TPM3

anti-Tropomyosin 3
YF-PA24885	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to Tropomyosin 3

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Mouse Tropomyosin Î² chain(TPM2) ELISA kit
E03T0729-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Tropomyosin Î² chain(TPM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Tropomyosin Î² chain(TPM2) ELISA kit
E03T0729-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Tropomyosin Î² chain(TPM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Tropomyosin Î² chain(TPM2) ELISA kit
E03T0729-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Tropomyosin Î² chain(TPM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Tropomyosin beta chain, Tpm2 ELISA KIT
ELI-39920m	Lifescience Market	96 Tests	EUR 865

Mouse Tropomyosin 2 Beta (TPM2) ELISA Kit
DLR-TPM2-Mu-48T	DL Develop	48T	EUR 527
Should the Mouse Tropomyosin 2 Beta (TPM2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Tropomyosin 2 Beta (TPM2) in samples from tissue homogenates or other biological fluids.

Mouse Tropomyosin 2 Beta (TPM2) ELISA Kit
DLR-TPM2-Mu-96T	DL Develop	96T	EUR 688
Should the Mouse Tropomyosin 2 Beta (TPM2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Tropomyosin 2 Beta (TPM2) in samples from tissue homogenates or other biological fluids.

Mouse Tropomyosin 2 Beta (TPM2) ELISA Kit
RDR-TPM2-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557

Mouse Tropomyosin 2 Beta (TPM2) ELISA Kit
RDR-TPM2-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774

Mouse Tropomyosin 2 Beta (TPM2) ELISA Kit
RD-TPM2-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533

Mouse Tropomyosin 2 Beta (TPM2) ELISA Kit
RD-TPM2-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740

Mouse Tropomyosin 2 Beta(TPM2)ELISA kit
QY-E21522	Qayee Biotechnology	96T	EUR 361

Mouse TPM3 shRNA Plasmid
20-abx975179	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

TPM3 Recombinant Protein (Mouse)
RP180722	ABM	100 ug	Ask for price

TPM3 Recombinant Protein (Mouse)
RP180725	ABM	100 ug	Ask for price

TPM3 Recombinant Protein (Mouse)
RP180728	ABM	100 ug	Ask for price

Tropomyosin 3 Blocking Peptide
33R-9034	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TPM3 antibody, catalog no. 70R-4890

Tpm3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3921304	ABM	1.0 ug DNA	EUR 154

TPM3 siRNA
20-abx905750	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TPM3 siRNA
20-abx937845	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TPM3 siRNA
20-abx937846	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TPM3 antibody
70R-20937	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal TPM3 antibody

TPM3 Antibody
ABD6338	Lifescience Market	100 ug	EUR 438

TPM3 Antibody
32227-100ul	SAB	100ul	EUR 252

TPM3 Antibody
DF6338	Affbiotech	200ul	EUR 304
Description: TPM3 Antibody detects endogenous levels of total TPM3.

TPM3 Antibody
1-CSB-PA024106GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20â„ƒ, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against TPM3. Recognizes TPM3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

TPM3 Antibody
1-CSB-PA024106LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TPM3. Recognizes TPM3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

Mouse Tropomyosin alpha-4 chain (TPM4) ELISA Kit
abx555580-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Mouse Tropomyosin Alpha 1 chain(TPM1) ELISA kit
E03T0728-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Tropomyosin Alpha 1 chain(TPM1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Tropomyosin Alpha 1 chain(TPM1) ELISA kit
E03T0728-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Tropomyosin Alpha 1 chain(TPM1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Tropomyosin Alpha 1 chain(TPM1) ELISA kit
E03T0728-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Tropomyosin Alpha 1 chain(TPM1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Tpm4/ Tropomyosin alpha-4 chain ELISA Kit
E1520Mo	Sunlong	1 Kit	EUR 632

Mouse Tropomyosin alpha- 1 chain, Tpm1 ELISA KIT
ELI-16432m	Lifescience Market	96 Tests	EUR 865

Mouse Tropomyosin alpha- 4 chain, Tpm4 ELISA KIT
ELI-51847m	Lifescience Market	96 Tests	EUR 865

Mouse Tropomyosin Receptor Kinase B (TRKB) ELISA Kit
abx050225-96tests	Abbexa	96 tests	EUR 770
Shipped within 5-10 working days.

Rat Tropomyosin isoform 5 ELISA kit
E02T0064-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Tropomyosin isoform 5 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Tropomyosin isoform 5 ELISA kit
E02T0064-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Tropomyosin isoform 5 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Tropomyosin isoform 5 ELISA kit
E02T0064-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Tropomyosin isoform 5 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Tropomyosin isoform 5 ELISA kit
E04T0064-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Tropomyosin isoform 5 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Tropomyosin isoform 5 ELISA kit
E04T0064-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Tropomyosin isoform 5 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Tropomyosin isoform 5 ELISA kit
E04T0064-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Tropomyosin isoform 5 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Tropomyosin isoform 5 ELISA kit
E01T0064-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Tropomyosin isoform 5 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Tropomyosin isoform 5 ELISA kit
E01T0064-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Tropomyosin isoform 5 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Tropomyosin isoform 5 ELISA kit
E01T0064-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Tropomyosin isoform 5 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Tropomyosin isoform 5 ELISA kit
E06T0064-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Tropomyosin isoform 5 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Tropomyosin isoform 5 ELISA kit
E06T0064-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Tropomyosin isoform 5 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Tropomyosin isoform 5 ELISA kit
E06T0064-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Tropomyosin isoform 5 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Tropomyosin isoform 5 ELISA kit
E08T0064-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Tropomyosin isoform 5 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Tropomyosin isoform 5 ELISA kit
E08T0064-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Tropomyosin isoform 5 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Tropomyosin isoform 5 ELISA kit
E08T0064-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Tropomyosin isoform 5 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Tropomyosin isoform 5 ELISA kit
E07T0064-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Tropomyosin isoform 5 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Tropomyosin isoform 5 ELISA kit
E07T0064-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Tropomyosin isoform 5 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Tropomyosin isoform 5 ELISA kit
E07T0064-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Tropomyosin isoform 5 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Tropomyosin isoform 5 ELISA kit
E09T0064-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Tropomyosin isoform 5 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Tropomyosin isoform 5 ELISA kit
E09T0064-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Tropomyosin isoform 5 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Tropomyosin isoform 5 ELISA kit
E09T0064-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Tropomyosin isoform 5 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human TPM4(Tropomyosin-4) ELISA Kit
EH13130	FN Test	96T	EUR 567.6
Detection range: 0.156-10 ng/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Tpm3 ORF Vector (Mouse) (pORF)
ORF060242	ABM	1.0 ug DNA	EUR 506

Tpm3 ORF Vector (Mouse) (pORF)
ORF060243	ABM	1.0 ug DNA	EUR 506

Tpm3 ORF Vector (Mouse) (pORF)
ORF060244	ABM	1.0 ug DNA	EUR 506

Shrimp tropomyosin
AG211	Unibiotest	1 mg	EUR 523

Shrimp tropomyosin
AT211	Unibiotest	1mg	EUR 1114

Tropomyosin antibody
10R-7905	Fitzgerald	100 ug	EUR 322
Description: Mouse monoclonal Tropomyosin antibody

Tropomyosin antibody
10R-7906	Fitzgerald	100 ug	EUR 322
Description: Mouse monoclonal Tropomyosin antibody

Tropomyosin antibody
10R-7907	Fitzgerald	100 ug	EUR 322
Description: Mouse monoclonal Tropomyosin antibody

Tropomyosin protein
30C-CP3034	Fitzgerald	100 ug	EUR 534
Description: Purified native Human Tropomyosin protein

Tropomyosin protein
30-1227	Fitzgerald	100 ug	EUR 858
Description: Purified native Human Tropomyosin protein

Tropomyosin Antibody
1-CSB-PA889027HA01DRR	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Tropomyosin. Recognizes Tropomyosin from Charybdis feriata. This antibody is Unconjugated. Tested in the following application: ELISA

Polyclonal TPM3 Antibody
APR03334G	Leading Biology	0.05ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TPM3 . This antibody is tested and proven to work in the following applications:

TPM3 Conjugated Antibody
C32227	SAB	100ul	EUR 397

TPM3 cloning plasmid
CSB-CL024106HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 Î¼g plasmid + 200Î¼l Glycerol Length: 858 Sequence: atgatggaggccatcaagaaaaagatgcagatgctgaagttagacaaggagaatgctctggatcgggcagagcaagctgaagctgagcagaagcaggcagaagaaagaagtaaacagctggaggatgagctggcagccatgcagaagaagctgaaagggacagaggatgagctgga Show more
Description: A cloning plasmid for the TPM3 gene.

TPM3 cloning plasmid
CSB-CL024106HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 Î¼g plasmid + 200Î¼l Glycerol Length: 747 Sequence: atggctgggatcaccaccatcgaggcggtgaagcgcaagatccaggttctgcagcagcaggcagatgatgcagaggagcgagctgagcgcctccagcgagaagttgagggagaaaggcgggcccgggaacaggctgaggctgaggtggcctccttgaaccgtaggatccagctggt Show more
Description: A cloning plasmid for the TPM3 gene.

TPM3 cloning plasmid
CSB-CL024106HU3-10ug	Cusabio	10ug	EUR 233
Formulation: 10 Î¼g plasmid + 200Î¼l Glycerol Length: 477 Sequence: atgaaggttattgaaaaccgggccttaaaagatgaagaaaagatggaactccaggaaatccaactcaaagaagctaagcacattgcagaagaggcagataggaagtatgaagaggtggctcgtaagttggtgatcattgaaggagacttggaacgcacagaggaacgagctgagct Show more
Description: A cloning plasmid for the TPM3 gene.

anti- TPM3 antibody
FNab08890	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:200 Immunogen: tropomyosin 3 Uniprot ID: P06753 Gene ID: 7170 Research Area: Neuroscience, Developmental biology
Description: Antibody raised against TPM3

anti- TPM3 antibody
FNab08891	FN Test	100µg	EUR 585
Immunogen: tropomyosin 3 Uniprot ID: P06753 Gene ID: 7170 Research Area: Neuroscience, Developmental biology
Description: Antibody raised against TPM3

TPM3 Rabbit pAb
A1206-100ul	Abclonal	100 ul	EUR 308

TPM3 Rabbit pAb
A1206-200ul	Abclonal	200 ul	EUR 459

TPM3 Rabbit pAb
A1206-20ul	Abclonal	20 ul	EUR 183

TPM3 Rabbit pAb
A1206-50ul	Abclonal	50 ul	EUR 223

TPM3 Rabbit pAb
A13557-100ul	Abclonal	100 ul	EUR 308

TPM3 Rabbit pAb
A13557-200ul	Abclonal	200 ul	EUR 459

TPM3 Rabbit pAb
A13557-20ul	Abclonal	20 ul	EUR 183

TPM3 Rabbit pAb
A13557-50ul	Abclonal	50 ul	EUR 223

TPM3 Blocking Peptide
DF6338-BP	Affbiotech	1mg	EUR 195

Anti-TPM3 antibody
PAab08890	Lifescience Market	100 ug	EUR 386

Anti-TPM3 antibody
PAab08891	Lifescience Market	100 ug	EUR 412

pCMV-SPORT6-TPM3
PVT14210	Lifescience Market	2 ug	EUR 495

Anti-TPM3 antibody
STJ25942	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the tropomyosin family of actin-binding proteins. Tropomyosins are dimers of coiled-coil proteins that provide stability to actin filaments and regulate access of other actin-binding proteins. Mutations in this gene result in autosomal dominant nemaline myopathy and other muscle disorders. This locus is involved in translocations with other loci, including anaplastic lymphoma receptor tyrosine kinase (ALK) and neurotrophic tyrosine kinase receptor type 1 (NTRK1), which result in the formation of fusion proteins that act as oncogenes. There are numerous pseudogenes for this gene on different chromosomes. Alternative splicing results in multiple transcript variants.

Anti-TPM3 antibody
STJ115518	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the tropomyosin family of actin-binding proteins. Tropomyosins are dimers of coiled-coil proteins that provide stability to actin filaments and regulate access of other actin-binding proteins. Mutations in this gene result in autosomal dominant nemaline myopathy and other muscle disorders. This locus is involved in translocations with other loci, including anaplastic lymphoma receptor tyrosine kinase (ALK) and neurotrophic tyrosine kinase receptor type 1 (NTRK1), which result in the formation of fusion proteins that act as oncogenes. There are numerous pseudogenes for this gene on different chromosomes. Alternative splicing results in multiple transcript variants.

Mouse TPM3(Tropomyosin 3) ELISA Kit