Rat MATN4(Matrilin 4) ELISA Kit

Rat MATN4(Matrilin 4) ELISA Kit

To Order Contact us: [email protected]

Rat Matrilin 4 (MATN4) ELISA Kit
4-SEE147Ra	Cloud-Clone	EUR 5175.00 EUR 2734.00 EUR 686.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Matrilin 4 elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Matrilin 4 (MATN4) in samples from serum, plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Matrilin 4 ELISA Kit (MATN4)
RK03804	Abclonal	96 Tests	EUR 521

Rat Matrilin 4 (MATN4) CLIA Kit
20-abx496521	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Matrilin 4 (MATN4) Antibody
20-abx005982	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Matrilin 4 (MATN4) Antibody
20-abx212006	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Matrilin 4 (MATN4) Antibody
20-abx212315	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Matrilin 4 (MATN4) Antibody
20-abx317011	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

ELISA kit for Rat MATN4 (Matrilin 4)
ELK7801	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Matrilin 4 (MATN4). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Matrilin 4 (MAT Show more
Description: A sandwich ELISA kit for detection of Matrilin 4 from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Matrilin- 4, MATN4 ELISA KIT
ELI-15735h	Lifescience Market	96 Tests	EUR 824

Mouse Matrilin- 4, Matn4 ELISA KIT
ELI-19576m	Lifescience Market	96 Tests	EUR 865

Human Matrilin 4(MATN4)ELISA Kit
QY-E02132	Qayee Biotechnology	96T	EUR 361

Matrilin 4 (MATN4) Antibody (HRP)
20-abx317012	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Matrilin 4 (MATN4) Antibody (FITC)
20-abx317013	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Matrilin 4 (MATN4) Antibody (Biotin)
20-abx317014	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

ELISA kit for Mouse Matrilin-4 (MATN4)
KTE71111-48T	Abbkine	48T	EUR 332
MATN4 encodes a member of von Willebrand factor A domain containing protein family. The proteins of this family are thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues. The specific functi Show more
Description: Quantitative sandwich ELISA for measuring Mouse Matrilin-4 (MATN4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Matrilin-4 (MATN4)
KTE71111-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
MATN4 encodes a member of von Willebrand factor A domain containing protein family. The proteins of this family are thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues. The specific functi Show more
Description: Quantitative sandwich ELISA for measuring Mouse Matrilin-4 (MATN4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Matrilin-4 (MATN4)
KTE71111-96T	Abbkine	96T	EUR 539
MATN4 encodes a member of von Willebrand factor A domain containing protein family. The proteins of this family are thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues. The specific functi Show more
Description: Quantitative sandwich ELISA for measuring Mouse Matrilin-4 (MATN4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Matrilin-4 (MATN4)
KTE61709-48T	Abbkine	48T	EUR 332
MATN4 encodes a member of von Willebrand factor A domain containing protein family. The proteins of this family are thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues. The specific functi Show more
Description: Quantitative sandwich ELISA for measuring Human Matrilin-4 (MATN4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Matrilin-4 (MATN4)
KTE61709-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
MATN4 encodes a member of von Willebrand factor A domain containing protein family. The proteins of this family are thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues. The specific functi Show more
Description: Quantitative sandwich ELISA for measuring Human Matrilin-4 (MATN4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Matrilin-4 (MATN4)
KTE61709-96T	Abbkine	96T	EUR 539
MATN4 encodes a member of von Willebrand factor A domain containing protein family. The proteins of this family are thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues. The specific functi Show more
Description: Quantitative sandwich ELISA for measuring Human Matrilin-4 (MATN4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Rat Matrilin-4 PicoKine ELISA Kit
EK2031	BosterBio	96 wells	EUR 425
Description: For quantitative detection of rat Matrilin-4 in cell culture supernates, serum and plasma (heparin, EDTA).

Mouse Matrilin-4 PicoKine ELISA Kit
EK2030	BosterBio	96 wells	EUR 425
Description: For quantitative detection of mouse Matrilin-4 in cell culture supernates, serum and plasma (heparin, EDTA).

Matn4 ELISA Kit (Rat) (OKBB01398)
OKBB01398	Aviva Systems Biology	96 Wells	EUR 505
Description: Description of target: Matrilin-4 is a 73 kDa secreted glycoprotein that is a member of the matrilin family of the von Willebrand Factor-A (vWA) domain-containing superfamily. This gene is mapped to 3q42. Matrilins are modular extracellular matrix proteins that serve as adaptors and linkers for other matrix proteins. Matrilin-4, like Matrilin‑2, has a broad distribution in both cartilage and in loose connective tissue such as dermis, lung and kidney, while Matrilins 1 and 3 are limited to cartilage. Matrilin-4 is present in nervous tissue and is abundant in the brain. Mature mouse Matrilin-4 shares 98%, 90%, 89% and 66% amino acid (aa) identity with rat, human, canine and chicken Matrilin-4, respectively. The 624 aa mouse Matrilin-4 contains a 22 aa signal sequence, two potential glycosylation sites, and four cysteine-rich EGF-like domains placed between two vWA domains. A short isoform lacks the N-terminal vWA domain (aa 28‑217). A C-terminal alpha -helix/coiled-coil region (aa 590‑623) by which multimers are formed is often proteolytically removed so that Matrilin-4 is found as a mixture of monomers with homo- or hetero- dimers and trimers. Matrilin-4 forms multimers with Matrilins 1 and 2 but not with Matrilin-3. The N-terminal vWA domains of Matrilins associate with collagen IV microfibrils via the proteoglycans biglycan and decorin, linking the fibrils with other matrix constituents aggrecan and collagen II. Matrilins also show calcium-dependent binding to the cartilage oligomeric matrix protein (COMP); this interaction is of high affinity for oligomeric Matrilin-4 and somewhat lower affinity for monomeric Matrilin-4. Functions and distributions of Matrilins overlap enough so that knockouts of Matrilins 1, 2 and 3 lack obvious phenotypes.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: <50pg/ml

Human Matrilin 2 (Matrilin 2) ELISA Kit
abx259685-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Rat Matrilin-3 PicoKine ELISA Kit
EK2024	BosterBio	96 wells	EUR 425
Description: For quantitative detection of rat Matrilin-3 in cell culture supernates, serum and plasma (heparin, EDTA).

Matrilin 2 ELISA KIT|Human
EF010853	Lifescience Market	96 Tests	EUR 689

Matrilin 2 (Matrilin 2) Antibody
abx235031-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Matn4 ELISA Kit (Mouse) (OKBB01397)
OKBB01397	Aviva Systems Biology	96 Wells	EUR 505
Description: Description of target: Matrilin-4 is a 73 kDa secreted glycoprotein that is a member of the matrilin family of the von Willebrand Factor-A (vWA) domain-containing superfamily. This gene is mapped to 2 H3; 2 85.16 cM. Matrilins are modular extracellular matrix proteins that serve as adaptors and linkers for other matrix proteins. Matrilin-4, like Matrilin‑2, has a broad distribution in both cartilage and in loose connective tissue such as dermis, lung and kidney, while Matrilins 1 and 3 are limited to cartilage. Matrilin-4 is present in nervous tissue and is abundant in the brain. Mature mouse Matrilin-4 shares 98%, 90%, 89% and 66% amino acid (aa) identity with rat, human, canine and chicken Matrilin-4, respectively. The 624 aa mouse Matrilin-4 contains a 22 aa signal sequence, two potential glycosylation sites, and four cysteine-rich EGF-like domains placed between two vWA domains. A short isoform lacks the N-terminal vWA domain (aa 28‑217). A C-terminal alpha -helix/coiled-coil region (aa 590‑623) by which multimers are formed is often proteolytically removed so that Matrilin-4 is found as a mixture of monomers with homo- or hetero- dimers and trimers. Matrilin-4 forms multimers with Matrilins 1 and 2 but not with Matrilin-3. The N-terminal vWA domains of Matrilins associate with collagen IV microfibrils via the proteoglycans biglycan and decorin, linking the fibrils with other matrix constituents aggrecan and collagen II. Matrilins also show calcium-dependent binding to the cartilage oligomeric matrix protein (COMP); this interaction is of high affinity for oligomeric Matrilin-4 and somewhat lower affinity for monomeric Matrilin-4. Functions and distributions of Matrilins overlap enough so that knockouts of Matrilins 1, 2 and 3 lack obvious phenotypes.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: <50pg/ml

MATN4 Recombinant Protein (Rat)
RP210965	ABM	100 ug	Ask for price

Liver Dissociation System 4 (Hepatocytes, rat), Rat
4-20304	CHI Scientific	ea	Ask for price

Matrilin-1
MO15126	Neuromics	100 ug	EUR 396

MATN4 Antibody
24870-100ul	SAB	100ul	EUR 390

MATN4 Antibody
35810-100ul	SAB	100ul	EUR 252

MATN4 Antibody
1-CSB-PA042030	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MATN4. Recognizes MATN4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:5000, WB:1:200-1:1000

MATN4 Antibody
1-CSB-PA202607	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MATN4. Recognizes MATN4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

MATN4 Antibody
1-CSB-PA013523LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MATN4. Recognizes MATN4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA

MATN4 siRNA
20-abx923626	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MATN4 siRNA
20-abx923627	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Mouse Matrilin 2 (MATN2) ELISA Kit
DLR-MATN2-Mu-48T	DL Develop	48T	EUR 527
Should the Mouse Matrilin 2 (MATN2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Matrilin 2 (MATN2) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Matrilin 2 (MATN2) ELISA Kit
DLR-MATN2-Mu-96T	DL Develop	96T	EUR 688
Should the Mouse Matrilin 2 (MATN2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Matrilin 2 (MATN2) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Matrilin 2 (MATN2) ELISA Kit
20-abx154358	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Matrilin-2 PicoKine ELISA Kit
EK2020	BosterBio	96 wells	EUR 425
Description: For quantitative detection of human Matrilin-2 in cell culture supernates, serum and plasma (heparin, EDTA).

Mouse Matrilin-2 PicoKine ELISA Kit
EK2021	BosterBio	96 wells	EUR 425
Description: For quantitative detection of mouse Matrilin-2 in cell culture supernates, serum and plasma (heparin, EDTA).

Human Matrilin-3 PicoKine ELISA Kit
EK2022	BosterBio	96 wells	EUR 425
Description: For quantitative detection of human Matrilin-3 in cell culture supernates, serum and plasma (heparin, EDTA).

Mouse Matrilin-3 PicoKine ELISA Kit
EK2023	BosterBio	96 wells	EUR 425
Description: For quantitative detection of mouse Matrilin-3 in cell culture supernates, serum and plasma (heparin, EDTA).

Human Matrilin- 2, MATN2 ELISA KIT
ELI-19573h	Lifescience Market	96 Tests	EUR 824

Human Matrilin- 3, MATN3 ELISA KIT
ELI-19574h	Lifescience Market	96 Tests	EUR 824

Mouse Matrilin- 3, Matn3 ELISA KIT
ELI-19575m	Lifescience Market	96 Tests	EUR 865

Chicken Matrilin- 3, MATN3 ELISA KIT
ELI-23709c	Lifescience Market	96 Tests	EUR 928

Mouse Matrilin- 2, Matn2 ELISA KIT
ELI-31478m	Lifescience Market	96 Tests	EUR 865

Human Matrilin 3(MATN3)ELISA Kit
QY-E02133	Qayee Biotechnology	96T	EUR 361

Human Matrilin 2(MATN2)ELISA Kit
QY-E02134	Qayee Biotechnology	96T	EUR 361

Human Matrilin 1(MATN1)ELISA Kit
QY-E02135	Qayee Biotechnology	96T	EUR 361

Mouse Matrilin 2 (MATN2) ELISA Kit
SEE149Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4862.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Matrilin 2 (MATN2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Matrilin 2 (MATN2) in tissue homogenates, cell lysates and other biological fluids.

Mouse Matrilin 2 (MATN2) ELISA Kit
SEE149Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 488.08
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Matrilin 2 (MATN2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Matrilin 2 (MATN2) in tissue homogenates, cell lysates and other biological fluids.

Mouse Matrilin 2 (MATN2) ELISA Kit
SEE149Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 654.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Matrilin 2 (MATN2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Matrilin 2 (MATN2) in tissue homogenates, cell lysates and other biological fluids.

Mouse Matrilin 2 (MATN2) ELISA Kit
SEE149Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2644.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Matrilin 2 (MATN2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Matrilin 2 (MATN2) in tissue homogenates, cell lysates and other biological fluids.

Mouse Matrilin 2 (MATN2) ELISA Kit
4-SEE149Mu	Cloud-Clone	EUR 4913.00 EUR 2595.00 EUR 655.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Matrilin 2 elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Matrilin 2 (MATN2) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Matrilin 2 (MATN2) ELISA Kit
RDR-MATN2-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557

Mouse Matrilin 2 (MATN2) ELISA Kit
RDR-MATN2-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774

Mouse Matrilin 2 (MATN2) ELISA Kit
RD-MATN2-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533

Mouse Matrilin 2 (MATN2) ELISA Kit
RD-MATN2-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740

Rat FibrOut 4, for brain, neural
4-20533	CHI Scientific	1 ml	Ask for price

Rat FibrOut 4, for brain, neural
4-20534	CHI Scientific	5 x 1 ml	Ask for price

Matn4 ORF Vector (Rat) (pORF)
ORF070323	ABM	1.0 ug DNA	EUR 506

Thymus Dissociation System 4 (Epithelial), Adult rat
4-20444	CHI Scientific	ea	Ask for price

ELISA kit for Mouse MATN2 (Matrilin 2)
ELK6429	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Matrilin 2 (MATN2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Matrilin 2 (MAT Show more
Description: A sandwich ELISA kit for detection of Matrilin 2 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse Matrilin-3 (MATN3)
KTE71112-48T	Abbkine	48T	EUR 332
Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif Show more
Description: Quantitative sandwich ELISA for measuring Mouse Matrilin-3 (MATN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Matrilin-3 (MATN3)
KTE71112-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif Show more
Description: Quantitative sandwich ELISA for measuring Mouse Matrilin-3 (MATN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Matrilin-3 (MATN3)
KTE71112-96T	Abbkine	96T	EUR 539
Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif Show more
Description: Quantitative sandwich ELISA for measuring Mouse Matrilin-3 (MATN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Matrilin-2 (MATN2)
KTE71384-48T	Abbkine	48T	EUR 332
Matrilin-2 is a member of the von Willebrand factor A domain containing protein family. This family of proteins is thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues.The specific function Show more
Description: Quantitative sandwich ELISA for measuring Mouse Matrilin-2 (MATN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Matrilin-2 (MATN2)
KTE71384-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Matrilin-2 is a member of the von Willebrand factor A domain containing protein family. This family of proteins is thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues.The specific function Show more
Description: Quantitative sandwich ELISA for measuring Mouse Matrilin-2 (MATN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Matrilin-2 (MATN2)
KTE71384-96T	Abbkine	96T	EUR 539
Matrilin-2 is a member of the von Willebrand factor A domain containing protein family. This family of proteins is thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues.The specific function Show more
Description: Quantitative sandwich ELISA for measuring Mouse Matrilin-2 (MATN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Matrilin-3 (MATN3)
KTE61710-48T	Abbkine	48T	EUR 332
Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif Show more
Description: Quantitative sandwich ELISA for measuring Human Matrilin-3 (MATN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Matrilin-3 (MATN3)
KTE61710-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif Show more
Description: Quantitative sandwich ELISA for measuring Human Matrilin-3 (MATN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Matrilin-3 (MATN3)
KTE61710-96T	Abbkine	96T	EUR 539
Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif Show more
Description: Quantitative sandwich ELISA for measuring Human Matrilin-3 (MATN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Matrilin-2 (MATN2)
KTE61711-48T	Abbkine	48T	EUR 332
Matrilin-2 is a member of the von Willebrand factor A domain containing protein family. This family of proteins is thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues.The specific function Show more
Description: Quantitative sandwich ELISA for measuring Human Matrilin-2 (MATN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Matrilin-2 (MATN2)
KTE61711-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Matrilin-2 is a member of the von Willebrand factor A domain containing protein family. This family of proteins is thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues.The specific function Show more
Description: Quantitative sandwich ELISA for measuring Human Matrilin-2 (MATN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Matrilin-2 (MATN2)
KTE61711-96T	Abbkine	96T	EUR 539
Matrilin-2 is a member of the von Willebrand factor A domain containing protein family. This family of proteins is thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues.The specific function Show more
Description: Quantitative sandwich ELISA for measuring Human Matrilin-2 (MATN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Chicken Matrilin-3 (MATN3)
KTE30122-48T	Abbkine	48T	EUR 354
Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif Show more
Description: Quantitative sandwich ELISA for measuring Chicken Matrilin-3 (MATN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Chicken Matrilin-3 (MATN3)
KTE30122-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif Show more
Description: Quantitative sandwich ELISA for measuring Chicken Matrilin-3 (MATN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Chicken Matrilin-3 (MATN3)
KTE30122-96T	Abbkine	96T	EUR 572
Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif Show more
Description: Quantitative sandwich ELISA for measuring Chicken Matrilin-3 (MATN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Cartilage Dissociation System 4 (Chondrocytes), Mouse and Rat
4-20234	CHI Scientific	ea	Ask for price

Pancreas Dissociation System 4 (Islets), Mouse and Rat
4-20374	CHI Scientific	ea	Ask for price

Skin Dissociation System 4 (Keratinocytes), Mouse and Rat
4-20434	CHI Scientific	ea	Ask for price

Matrilin 2 antibody
70R-12133	Fitzgerald	100 ug	EUR 403
Description: Rabbit polyclonal Matrilin 2 antibody

Matrilin 2 antibody
70R-2250	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal Matrilin 2 antibody raised against the middle region of MATN2

Matrilin-2 Antibody
3840-100	Biovision		EUR 316

Matrilin-2 Antibody
3840-30T	Biovision		EUR 146

Matrilin 3 antibody
70R-5334	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal Matrilin 3 antibody raised against the N terminal of MATN3

Matrilin 3 antibody
70R-5335	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal Matrilin 3 antibody raised against the middle region of MATN3

Matrilin 1 antibody
70R-5353	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal Matrilin 1 antibody raised against the middle region of MATN1

anti-Matrilin 2
YF-PA13069	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to Matrilin 2

anti-Matrilin 2
YF-PA13070	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to Matrilin 2

anti-Matrilin 2
YF-PA24122	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to Matrilin 2

Polyclonal MATN4 Antibody
APR17343G	Leading Biology	0.1 mg	EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MATN4 . This antibody is tested and proven to work in the following applications:

MATN4 Conjugated Antibody
C35810	SAB	100ul	EUR 397

MATN4 cloning plasmid
CSB-CL013523HU1-10ug	Cusabio	10ug	EUR 565
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1623 Sequence: ATGAGAGGCCTTCTTTGCTGGCCCGTGTTGCTGCTCCTTCTTCAGCCCTGGGAAACCCAGCTCCAGTTGACAGGTCCCAGGTGTCACACTGGGCCCCTGGATCTGGTGTTCGTGATTGACAGCTCCCGCAGCGTGCGCCCTTTCGAGTTCGAGACCATGCGGCAGTTCCTCATGG Show more
Description: A cloning plasmid for the MATN4 gene.

MATN4 cloning plasmid
CSB-CL013523HU2-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1746 Sequence: ATGAGAGGCCTTCTTTGCTGGCCCGTGTTGCTGCTCCTTCTTCAGCCCTGGGAAACCCAGCTCCAGTTGACAGGTCCCAGGTGTCACACTGGGCCCCTGGATCTGGTGTTCGTGATTGACAGCTCCCGCAGCGTGCGCCCTTTCGAGTTCGAGACCATGCGGCAGTTCCTCATGG Show more
Description: A cloning plasmid for the MATN4 gene.

MATN4 Rabbit pAb
A2761-100ul	Abclonal	100 ul	EUR 308

MATN4 Rabbit pAb
A2761-200ul	Abclonal	200 ul	EUR 459

MATN4 Rabbit pAb
A2761-20ul	Abclonal	20 ul	EUR 183

MATN4 Rabbit pAb
A2761-50ul	Abclonal	50 ul	EUR 223

MATN4 Polyclonal Antibody
ABP59229-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human MATN4 protein at amino acid sequence of 30-110 Applications tips:
Description: A polyclonal antibody for detection of MATN4 from Human, Mouse. This MATN4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MATN4 protein at amino acid sequence of 30-110

MATN4 Polyclonal Antibody
ABP59229-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human MATN4 protein at amino acid sequence of 30-110 Applications tips:
Description: A polyclonal antibody for detection of MATN4 from Human, Mouse. This MATN4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MATN4 protein at amino acid sequence of 30-110

MATN4 Polyclonal Antibody
ABP59229-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human MATN4 protein at amino acid sequence of 30-110 Applications tips:
Description: A polyclonal antibody for detection of MATN4 from Human, Mouse. This MATN4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MATN4 protein at amino acid sequence of 30-110

MATN4 Polyclonal Antibody
ES11212-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against MATN4 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

MATN4 Polyclonal Antibody
ES11212-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against MATN4 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-MATN4 antibody
STJ24506	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of von Willebrand factor A domain-containing protein family. The proteins of this family are thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues. This family member is thought to be play a role in reorganizing and regenerating the corneal matrix in granular and lattice type I dystrophies. It may also be involved in wound healing in the dentin-pulp complex. Alternative splicing results in multiple transcript variants.

Anti-MATN4 antibody
STJ192370	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to MATN4

IL-4 Interleukin 4 Human Recombinant Protein, Yeast
PROTP05112-4	BosterBio	Regular: 10ug	EUR 317
Description: Interleukin-4 Human Recombinant produced in yeast is a single, glycosylated polypeptide chain containing 129 amino acids.;The IL-4 is purified by proprietary chromatographic techniques.

Custom production of antibodies in 5 Rats using customer supplied antigen (std 63 days protocol)
RAT-5	Alpha Diagnostics	1	EUR 1138

Adipose/Fat Dissociation System 4 (Predipocytes), Mouse and Rat
4-20194	CHI Scientific	ea	Ask for price

Brain Dissociation System 4 (Endothelial, Microvessels), Mouse and Rat
4-20224	CHI Scientific	ea	Ask for price

Endothelial Dissociation System 4 (Endothelial,Cerebral), Mouse and Rat
4-20244	CHI Scientific	ea	Ask for price

Heart Dissociation System 4 (Myocytes,Ventricles), Mouse and Rat
4-20274	CHI Scientific	ea	Ask for price

Muscle Dissociation System 4 (Smooth muscle), Mouse and Rat
4-20334	CHI Scientific	ea	Ask for price

Parotid Dissociation System 4 (Parotid acinar), Mouse and Rat
4-20394	CHI Scientific	ea	Ask for price

Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit
DLR-CA72-4-Hu-48T	DL Develop	48T	EUR 479
Should the Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Carbohydrate Antigen 72-4 (CA72-4) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit
DLR-CA72-4-Hu-96T	DL Develop	96T	EUR 621
Should the Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Carbohydrate Antigen 72-4 (CA72-4) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit
RDR-CA72-4-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit
RDR-CA72-4-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit
RD-CA72-4-Hu-48Tests	Reddot Biotech	48 Tests	EUR 478

Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit
RD-CA72-4-Hu-96Tests	Reddot Biotech	96 Tests	EUR 662

Matn4 sgRNA CRISPR Lentivector set (Rat)
K6374101	ABM	3 x 1.0 ug	EUR 339

Epithelial Dissociation System 4 (Epithelial,Submandibular salivary), Mouse and Rat
4-20254	CHI Scientific	ea	Ask for price

Heart Dissociation System 4 (Retinal pigment epithelial), Mouse and Rat
4-20294	CHI Scientific	ea	Ask for price

Lung Dissociation System 4 (Alveolar type II), Mouse and Rat
4-20314	CHI Scientific	ea	Ask for price

Reproductive Tissue Dissociation System 4 (Epithelial, vagina), Mouse and Rat
4-20414	CHI Scientific	ea	Ask for price

Individual Reaction Mix 4
G065-4	ABM	200 reactions	EUR 167

Mouse Matrilin 2 (MATN2) CLIA Kit
20-abx494521	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Adrenal Dissociation System 4 (Heart, Adrenal chromaffin, Paraneurons), Mouse and Rat
4-20204	CHI Scientific	ea	Ask for price

Kidney Dissociation System 4 (Inner medullary duct,Papillae), Mouse and Rat
4-29294	CHI Scientific	ea	Ask for price

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Matrilin 3 Blocking Peptide
33R-3946	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MATN3 antibody, catalog no. 70R-5335

Matrilin 1 Blocking Peptide
33R-4743	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MATN1 antibody, catalog no. 70R-5353

Matrilin 2 Blocking Peptide
33R-10950	Fitzgerald	50 ug	EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Matrilin 2 antibody, catalog no. 70R-12133

Matrilin 3 Blocking Peptide
33R-1471	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MATN3 antibody, catalog no. 70R-5334

Matrilin 2 Blocking Peptide
33R-1598	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MATN2 antibody, catalog no. 70R-2250

Matrilin-2 Blocking Peptide
3840BP-50	Biovision		EUR 153

Matrilin 3 (MATN3) Antibody
20-abx006513	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Rat MATN4(Matrilin 4) ELISA Kit