Rat MATN4(Matrilin 4) ELISA Kit
To Order Contact us: [email protected]
Rat Matrilin 4 (MATN4) ELISA Kit |
4-SEE147Ra |
Cloud-Clone |
-
EUR 5175.00
-
EUR 2734.00
-
EUR 686.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Matrilin 4 elisa. Alternative names of the recognized antigen: n/a
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Matrilin 4 (MATN4) in samples from serum, plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Rat Matrilin 4 ELISA Kit (MATN4) |
RK03804 |
Abclonal |
96 Tests |
EUR 521 |
Rat Matrilin 4 (MATN4) CLIA Kit |
20-abx496521 |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Matrilin 4 (MATN4) Antibody |
20-abx005982 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Matrilin 4 (MATN4) Antibody |
20-abx212006 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Matrilin 4 (MATN4) Antibody |
20-abx212315 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Matrilin 4 (MATN4) Antibody |
20-abx317011 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
ELISA kit for Rat MATN4 (Matrilin 4) |
ELK7801 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Matrilin 4 (MATN4). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Matrilin 4 (MAT
- Show more
|
Description: A sandwich ELISA kit for detection of Matrilin 4 from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Matrilin 4 (MATN4) Antibody (HRP) |
20-abx317012 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Matrilin 4 (MATN4) Antibody (FITC) |
20-abx317013 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Matrilin 4 (MATN4) Antibody (Biotin) |
20-abx317014 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
ELISA kit for Mouse Matrilin-4 (MATN4) |
KTE71111-48T |
Abbkine |
48T |
EUR 332 |
- MATN4 encodes a member of von Willebrand factor A domain containing protein family. The proteins of this family are thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues. The specific functi
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Matrilin-4 (MATN4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Matrilin-4 (MATN4) |
KTE71111-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- MATN4 encodes a member of von Willebrand factor A domain containing protein family. The proteins of this family are thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues. The specific functi
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Matrilin-4 (MATN4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Matrilin-4 (MATN4) |
KTE71111-96T |
Abbkine |
96T |
EUR 539 |
- MATN4 encodes a member of von Willebrand factor A domain containing protein family. The proteins of this family are thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues. The specific functi
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Matrilin-4 (MATN4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Matrilin-4 (MATN4) |
KTE61709-48T |
Abbkine |
48T |
EUR 332 |
- MATN4 encodes a member of von Willebrand factor A domain containing protein family. The proteins of this family are thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues. The specific functi
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Matrilin-4 (MATN4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Matrilin-4 (MATN4) |
KTE61709-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- MATN4 encodes a member of von Willebrand factor A domain containing protein family. The proteins of this family are thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues. The specific functi
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Matrilin-4 (MATN4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Matrilin-4 (MATN4) |
KTE61709-96T |
Abbkine |
96T |
EUR 539 |
- MATN4 encodes a member of von Willebrand factor A domain containing protein family. The proteins of this family are thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues. The specific functi
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Matrilin-4 (MATN4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Rat Matrilin-4 PicoKine ELISA Kit |
EK2031 |
BosterBio |
96 wells |
EUR 425 |
Description: For quantitative detection of rat Matrilin-4 in cell culture supernates, serum and plasma (heparin, EDTA). |
Mouse Matrilin-4 PicoKine ELISA Kit |
EK2030 |
BosterBio |
96 wells |
EUR 425 |
Description: For quantitative detection of mouse Matrilin-4 in cell culture supernates, serum and plasma (heparin, EDTA). |
Matn4 ELISA Kit (Rat) (OKBB01398) |
OKBB01398 |
Aviva Systems Biology |
96 Wells |
EUR 505 |
Description: Description of target: Matrilin-4 is a 73 kDa secreted glycoprotein that is a member of the matrilin family of the von Willebrand Factor-A (vWA) domain-containing superfamily. This gene is mapped to 3q42. Matrilins are modular extracellular matrix proteins that serve as adaptors and linkers for other matrix proteins. Matrilin-4, like Matrilin‑2, has a broad distribution in both cartilage and in loose connective tissue such as dermis, lung and kidney, while Matrilins 1 and 3 are limited to cartilage. Matrilin-4 is present in nervous tissue and is abundant in the brain. Mature mouse Matrilin-4 shares 98%, 90%, 89% and 66% amino acid (aa) identity with rat, human, canine and chicken Matrilin-4, respectively. The 624 aa mouse Matrilin-4 contains a 22 aa signal sequence, two potential glycosylation sites, and four cysteine-rich EGF-like domains placed between two vWA domains. A short isoform lacks the N-terminal vWA domain (aa 28‑217). A C-terminal alpha -helix/coiled-coil region (aa 590‑623) by which multimers are formed is often proteolytically removed so that Matrilin-4 is found as a mixture of monomers with homo- or hetero- dimers and trimers. Matrilin-4 forms multimers with Matrilins 1 and 2 but not with Matrilin-3. The N-terminal vWA domains of Matrilins associate with collagen IV microfibrils via the proteoglycans biglycan and decorin, linking the fibrils with other matrix constituents aggrecan and collagen II. Matrilins also show calcium-dependent binding to the cartilage oligomeric matrix protein (COMP); this interaction is of high affinity for oligomeric Matrilin-4 and somewhat lower affinity for monomeric Matrilin-4. Functions and distributions of Matrilins overlap enough so that knockouts of Matrilins 1, 2 and 3 lack obvious phenotypes.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: <50pg/ml |
Human Matrilin 2 (Matrilin 2) ELISA Kit |
abx259685-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Rat Matrilin-3 PicoKine ELISA Kit |
EK2024 |
BosterBio |
96 wells |
EUR 425 |
Description: For quantitative detection of rat Matrilin-3 in cell culture supernates, serum and plasma (heparin, EDTA). |
Matrilin 2 (Matrilin 2) Antibody |
abx235031-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Matn4 ELISA Kit (Mouse) (OKBB01397) |
OKBB01397 |
Aviva Systems Biology |
96 Wells |
EUR 505 |
Description: Description of target: Matrilin-4 is a 73 kDa secreted glycoprotein that is a member of the matrilin family of the von Willebrand Factor-A (vWA) domain-containing superfamily. This gene is mapped to 2 H3; 2 85.16 cM. Matrilins are modular extracellular matrix proteins that serve as adaptors and linkers for other matrix proteins. Matrilin-4, like Matrilin‑2, has a broad distribution in both cartilage and in loose connective tissue such as dermis, lung and kidney, while Matrilins 1 and 3 are limited to cartilage. Matrilin-4 is present in nervous tissue and is abundant in the brain. Mature mouse Matrilin-4 shares 98%, 90%, 89% and 66% amino acid (aa) identity with rat, human, canine and chicken Matrilin-4, respectively. The 624 aa mouse Matrilin-4 contains a 22 aa signal sequence, two potential glycosylation sites, and four cysteine-rich EGF-like domains placed between two vWA domains. A short isoform lacks the N-terminal vWA domain (aa 28‑217). A C-terminal alpha -helix/coiled-coil region (aa 590‑623) by which multimers are formed is often proteolytically removed so that Matrilin-4 is found as a mixture of monomers with homo- or hetero- dimers and trimers. Matrilin-4 forms multimers with Matrilins 1 and 2 but not with Matrilin-3. The N-terminal vWA domains of Matrilins associate with collagen IV microfibrils via the proteoglycans biglycan and decorin, linking the fibrils with other matrix constituents aggrecan and collagen II. Matrilins also show calcium-dependent binding to the cartilage oligomeric matrix protein (COMP); this interaction is of high affinity for oligomeric Matrilin-4 and somewhat lower affinity for monomeric Matrilin-4. Functions and distributions of Matrilins overlap enough so that knockouts of Matrilins 1, 2 and 3 lack obvious phenotypes.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: <50pg/ml |
MATN4 Recombinant Protein (Rat) |
RP210965 |
ABM |
100 ug |
Ask for price |
Liver Dissociation System 4 (Hepatocytes, rat), Rat |
4-20304 |
CHI Scientific |
ea |
Ask for price |
MATN4 Antibody |
24870-100ul |
SAB |
100ul |
EUR 390 |
MATN4 Antibody |
35810-100ul |
SAB |
100ul |
EUR 252 |
MATN4 Antibody |
1-CSB-PA042030 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against MATN4. Recognizes MATN4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:5000, WB:1:200-1:1000 |
MATN4 Antibody |
1-CSB-PA202607 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against MATN4. Recognizes MATN4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000 |
MATN4 Antibody |
1-CSB-PA013523LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against MATN4. Recognizes MATN4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA |
MATN4 siRNA |
20-abx923626 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MATN4 siRNA |
20-abx923627 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
Mouse Matrilin 2 (MATN2) ELISA Kit |
DLR-MATN2-Mu-48T |
DL Develop |
48T |
EUR 527 |
- Should the Mouse Matrilin 2 (MATN2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Matrilin 2 (MATN2) in samples from tissue homogenates, cell lysates or other biological fluids. |
Mouse Matrilin 2 (MATN2) ELISA Kit |
DLR-MATN2-Mu-96T |
DL Develop |
96T |
EUR 688 |
- Should the Mouse Matrilin 2 (MATN2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Matrilin 2 (MATN2) in samples from tissue homogenates, cell lysates or other biological fluids. |
Mouse Matrilin 2 (MATN2) ELISA Kit |
20-abx154358 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Matrilin-2 PicoKine ELISA Kit |
EK2020 |
BosterBio |
96 wells |
EUR 425 |
Description: For quantitative detection of human Matrilin-2 in cell culture supernates, serum and plasma (heparin, EDTA). |
Mouse Matrilin-2 PicoKine ELISA Kit |
EK2021 |
BosterBio |
96 wells |
EUR 425 |
Description: For quantitative detection of mouse Matrilin-2 in cell culture supernates, serum and plasma (heparin, EDTA). |
Human Matrilin-3 PicoKine ELISA Kit |
EK2022 |
BosterBio |
96 wells |
EUR 425 |
Description: For quantitative detection of human Matrilin-3 in cell culture supernates, serum and plasma (heparin, EDTA). |
Mouse Matrilin-3 PicoKine ELISA Kit |
EK2023 |
BosterBio |
96 wells |
EUR 425 |
Description: For quantitative detection of mouse Matrilin-3 in cell culture supernates, serum and plasma (heparin, EDTA). |
Mouse Matrilin 2 (MATN2) ELISA Kit |
SEE149Mu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4862.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Matrilin 2 (MATN2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Matrilin 2 (MATN2) in tissue homogenates, cell lysates and other biological fluids. |
Mouse Matrilin 2 (MATN2) ELISA Kit |
SEE149Mu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 488.08 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Matrilin 2 (MATN2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Matrilin 2 (MATN2) in tissue homogenates, cell lysates and other biological fluids. |
Mouse Matrilin 2 (MATN2) ELISA Kit |
SEE149Mu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 654.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Matrilin 2 (MATN2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Matrilin 2 (MATN2) in tissue homogenates, cell lysates and other biological fluids. |
Mouse Matrilin 2 (MATN2) ELISA Kit |
SEE149Mu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2644.8 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Matrilin 2 (MATN2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Matrilin 2 (MATN2) in tissue homogenates, cell lysates and other biological fluids. |
Mouse Matrilin 2 (MATN2) ELISA Kit |
4-SEE149Mu |
Cloud-Clone |
-
EUR 4913.00
-
EUR 2595.00
-
EUR 655.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Matrilin 2 elisa. Alternative names of the recognized antigen: n/a
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Matrilin 2 (MATN2) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Mouse Matrilin 2 (MATN2) ELISA Kit |
RDR-MATN2-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Mouse Matrilin 2 (MATN2) ELISA Kit |
RDR-MATN2-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 774 |
Mouse Matrilin 2 (MATN2) ELISA Kit |
RD-MATN2-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 533 |
Mouse Matrilin 2 (MATN2) ELISA Kit |
RD-MATN2-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 740 |
Rat FibrOut 4, for brain, neural |
4-20533 |
CHI Scientific |
1 ml |
Ask for price |
Rat FibrOut 4, for brain, neural |
4-20534 |
CHI Scientific |
5 x 1 ml |
Ask for price |
Matn4 ORF Vector (Rat) (pORF) |
ORF070323 |
ABM |
1.0 ug DNA |
EUR 506 |
Thymus Dissociation System 4 (Epithelial), Adult rat |
4-20444 |
CHI Scientific |
ea |
Ask for price |
ELISA kit for Mouse MATN2 (Matrilin 2) |
ELK6429 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Matrilin 2 (MATN2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Matrilin 2 (MAT
- Show more
|
Description: A sandwich ELISA kit for detection of Matrilin 2 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Mouse Matrilin-3 (MATN3) |
KTE71112-48T |
Abbkine |
48T |
EUR 332 |
- Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Matrilin-3 (MATN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Matrilin-3 (MATN3) |
KTE71112-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Matrilin-3 (MATN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Matrilin-3 (MATN3) |
KTE71112-96T |
Abbkine |
96T |
EUR 539 |
- Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Matrilin-3 (MATN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Matrilin-2 (MATN2) |
KTE71384-48T |
Abbkine |
48T |
EUR 332 |
- Matrilin-2 is a member of the von Willebrand factor A domain containing protein family. This family of proteins is thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues.The specific function
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Matrilin-2 (MATN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Matrilin-2 (MATN2) |
KTE71384-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Matrilin-2 is a member of the von Willebrand factor A domain containing protein family. This family of proteins is thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues.The specific function
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Matrilin-2 (MATN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Matrilin-2 (MATN2) |
KTE71384-96T |
Abbkine |
96T |
EUR 539 |
- Matrilin-2 is a member of the von Willebrand factor A domain containing protein family. This family of proteins is thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues.The specific function
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Matrilin-2 (MATN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Matrilin-3 (MATN3) |
KTE61710-48T |
Abbkine |
48T |
EUR 332 |
- Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Matrilin-3 (MATN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Matrilin-3 (MATN3) |
KTE61710-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Matrilin-3 (MATN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Matrilin-3 (MATN3) |
KTE61710-96T |
Abbkine |
96T |
EUR 539 |
- Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Matrilin-3 (MATN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Matrilin-2 (MATN2) |
KTE61711-48T |
Abbkine |
48T |
EUR 332 |
- Matrilin-2 is a member of the von Willebrand factor A domain containing protein family. This family of proteins is thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues.The specific function
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Matrilin-2 (MATN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Matrilin-2 (MATN2) |
KTE61711-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Matrilin-2 is a member of the von Willebrand factor A domain containing protein family. This family of proteins is thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues.The specific function
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Matrilin-2 (MATN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Matrilin-2 (MATN2) |
KTE61711-96T |
Abbkine |
96T |
EUR 539 |
- Matrilin-2 is a member of the von Willebrand factor A domain containing protein family. This family of proteins is thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues.The specific function
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Matrilin-2 (MATN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Chicken Matrilin-3 (MATN3) |
KTE30122-48T |
Abbkine |
48T |
EUR 354 |
- Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
- Show more
|
Description: Quantitative sandwich ELISA for measuring Chicken Matrilin-3 (MATN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Chicken Matrilin-3 (MATN3) |
KTE30122-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2252 |
- Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
- Show more
|
Description: Quantitative sandwich ELISA for measuring Chicken Matrilin-3 (MATN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Chicken Matrilin-3 (MATN3) |
KTE30122-96T |
Abbkine |
96T |
EUR 572 |
- Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
- Show more
|
Description: Quantitative sandwich ELISA for measuring Chicken Matrilin-3 (MATN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Cartilage Dissociation System 4 (Chondrocytes), Mouse and Rat |
4-20234 |
CHI Scientific |
ea |
Ask for price |
Pancreas Dissociation System 4 (Islets), Mouse and Rat |
4-20374 |
CHI Scientific |
ea |
Ask for price |
Skin Dissociation System 4 (Keratinocytes), Mouse and Rat |
4-20434 |
CHI Scientific |
ea |
Ask for price |
Matrilin 2 antibody |
70R-12133 |
Fitzgerald |
100 ug |
EUR 403 |
Description: Rabbit polyclonal Matrilin 2 antibody |
Matrilin 2 antibody |
70R-2250 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal Matrilin 2 antibody raised against the middle region of MATN2 |
Matrilin-2 Antibody |
3840-100 |
Biovision |
|
EUR 316 |
Matrilin-2 Antibody |
3840-30T |
Biovision |
|
EUR 146 |
Matrilin 3 antibody |
70R-5334 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal Matrilin 3 antibody raised against the N terminal of MATN3 |
Matrilin 3 antibody |
70R-5335 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal Matrilin 3 antibody raised against the middle region of MATN3 |
Matrilin 1 antibody |
70R-5353 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal Matrilin 1 antibody raised against the middle region of MATN1 |
anti-Matrilin 2 |
YF-PA13069 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to Matrilin 2 |
anti-Matrilin 2 |
YF-PA13070 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to Matrilin 2 |
anti-Matrilin 2 |
YF-PA24122 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to Matrilin 2 |
Polyclonal MATN4 Antibody |
APR17343G |
Leading Biology |
0.1 mg |
EUR 659 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MATN4 . This antibody is tested and proven to work in the following applications: |
MATN4 Conjugated Antibody |
C35810 |
SAB |
100ul |
EUR 397 |
MATN4 cloning plasmid |
CSB-CL013523HU1-10ug |
Cusabio |
10ug |
EUR 565 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1623
- Sequence: ATGAGAGGCCTTCTTTGCTGGCCCGTGTTGCTGCTCCTTCTTCAGCCCTGGGAAACCCAGCTCCAGTTGACAGGTCCCAGGTGTCACACTGGGCCCCTGGATCTGGTGTTCGTGATTGACAGCTCCCGCAGCGTGCGCCCTTTCGAGTTCGAGACCATGCGGCAGTTCCTCATGG
- Show more
|
Description: A cloning plasmid for the MATN4 gene. |
MATN4 cloning plasmid |
CSB-CL013523HU2-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1746
- Sequence: ATGAGAGGCCTTCTTTGCTGGCCCGTGTTGCTGCTCCTTCTTCAGCCCTGGGAAACCCAGCTCCAGTTGACAGGTCCCAGGTGTCACACTGGGCCCCTGGATCTGGTGTTCGTGATTGACAGCTCCCGCAGCGTGCGCCCTTTCGAGTTCGAGACCATGCGGCAGTTCCTCATGG
- Show more
|
Description: A cloning plasmid for the MATN4 gene. |
MATN4 Rabbit pAb |
A2761-100ul |
Abclonal |
100 ul |
EUR 308 |
MATN4 Rabbit pAb |
A2761-200ul |
Abclonal |
200 ul |
EUR 459 |
MATN4 Rabbit pAb |
A2761-20ul |
Abclonal |
20 ul |
EUR 183 |
MATN4 Rabbit pAb |
A2761-50ul |
Abclonal |
50 ul |
EUR 223 |
MATN4 Polyclonal Antibody |
ABP59229-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human MATN4 protein at amino acid sequence of 30-110
- Applications tips:
|
Description: A polyclonal antibody for detection of MATN4 from Human, Mouse. This MATN4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MATN4 protein at amino acid sequence of 30-110 |
MATN4 Polyclonal Antibody |
ABP59229-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human MATN4 protein at amino acid sequence of 30-110
- Applications tips:
|
Description: A polyclonal antibody for detection of MATN4 from Human, Mouse. This MATN4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MATN4 protein at amino acid sequence of 30-110 |
MATN4 Polyclonal Antibody |
ABP59229-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human MATN4 protein at amino acid sequence of 30-110
- Applications tips:
|
Description: A polyclonal antibody for detection of MATN4 from Human, Mouse. This MATN4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MATN4 protein at amino acid sequence of 30-110 |
MATN4 Polyclonal Antibody |
ES11212-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MATN4 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
MATN4 Polyclonal Antibody |
ES11212-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MATN4 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
Anti-MATN4 antibody |
STJ24506 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of von Willebrand factor A domain-containing protein family. The proteins of this family are thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues. This family member is thought to be play a role in reorganizing and regenerating the corneal matrix in granular and lattice type I dystrophies. It may also be involved in wound healing in the dentin-pulp complex. Alternative splicing results in multiple transcript variants. |
Anti-MATN4 antibody |
STJ192370 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to MATN4 |
IL-4 Interleukin 4 Human Recombinant Protein, Yeast |
PROTP05112-4 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: Interleukin-4 Human Recombinant produced in yeast is a single, glycosylated polypeptide chain containing 129 amino acids.;The IL-4 is purified by proprietary chromatographic techniques. |
Custom production of antibodies in 5 Rats using customer supplied antigen (std 63 days protocol) |
RAT-5 |
Alpha Diagnostics |
1 |
EUR 1138 |
Adipose/Fat Dissociation System 4 (Predipocytes), Mouse and Rat |
4-20194 |
CHI Scientific |
ea |
Ask for price |
Brain Dissociation System 4 (Endothelial, Microvessels), Mouse and Rat |
4-20224 |
CHI Scientific |
ea |
Ask for price |
Endothelial Dissociation System 4 (Endothelial,Cerebral), Mouse and Rat |
4-20244 |
CHI Scientific |
ea |
Ask for price |
Heart Dissociation System 4 (Myocytes,Ventricles), Mouse and Rat |
4-20274 |
CHI Scientific |
ea |
Ask for price |
Muscle Dissociation System 4 (Smooth muscle), Mouse and Rat |
4-20334 |
CHI Scientific |
ea |
Ask for price |
Parotid Dissociation System 4 (Parotid acinar), Mouse and Rat |
4-20394 |
CHI Scientific |
ea |
Ask for price |
Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit |
DLR-CA72-4-Hu-48T |
DL Develop |
48T |
EUR 479 |
- Should the Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Carbohydrate Antigen 72-4 (CA72-4) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit |
DLR-CA72-4-Hu-96T |
DL Develop |
96T |
EUR 621 |
- Should the Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Carbohydrate Antigen 72-4 (CA72-4) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit |
RDR-CA72-4-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit |
RDR-CA72-4-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit |
RD-CA72-4-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 478 |
Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit |
RD-CA72-4-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 662 |
Matn4 sgRNA CRISPR Lentivector set (Rat) |
K6374101 |
ABM |
3 x 1.0 ug |
EUR 339 |
Epithelial Dissociation System 4 (Epithelial,Submandibular salivary), Mouse and Rat |
4-20254 |
CHI Scientific |
ea |
Ask for price |
Heart Dissociation System 4 (Retinal pigment epithelial), Mouse and Rat |
4-20294 |
CHI Scientific |
ea |
Ask for price |
Lung Dissociation System 4 (Alveolar type II), Mouse and Rat |
4-20314 |
CHI Scientific |
ea |
Ask for price |
Reproductive Tissue Dissociation System 4 (Epithelial, vagina), Mouse and Rat |
4-20414 |
CHI Scientific |
ea |
Ask for price |
Individual Reaction Mix 4 |
G065-4 |
ABM |
200 reactions |
EUR 167 |
Mouse Matrilin 2 (MATN2) CLIA Kit |
20-abx494521 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Adrenal Dissociation System 4 (Heart, Adrenal chromaffin, Paraneurons), Mouse and Rat |
4-20204 |
CHI Scientific |
ea |
Ask for price |
Kidney Dissociation System 4 (Inner medullary duct,Papillae), Mouse and Rat |
4-29294 |
CHI Scientific |
ea |
Ask for price |
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
Matrilin 3 Blocking Peptide |
33R-3946 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MATN3 antibody, catalog no. 70R-5335 |
Matrilin 1 Blocking Peptide |
33R-4743 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MATN1 antibody, catalog no. 70R-5353 |
Matrilin 2 Blocking Peptide |
33R-10950 |
Fitzgerald |
50 ug |
EUR 191 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Matrilin 2 antibody, catalog no. 70R-12133 |
Matrilin 3 Blocking Peptide |
33R-1471 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MATN3 antibody, catalog no. 70R-5334 |
Matrilin 2 Blocking Peptide |
33R-1598 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MATN2 antibody, catalog no. 70R-2250 |
Matrilin-2 Blocking Peptide |
3840BP-50 |
Biovision |
|
EUR 153 |
Matrilin 3 (MATN3) Antibody |
20-abx006513 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Rat MATN4(Matrilin 4) ELISA Kit