Rat MATN4(Matrilin 4) ELISA Kit

Rat MATN4(Matrilin 4) ELISA Kit

To Order Contact us: [email protected]

Rat Matrilin 4 (MATN4) ELISA Kit
4-SEE147Ra
  • EUR 5175.00
  • EUR 2734.00
  • EUR 686.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Matrilin 4 elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Matrilin 4 (MATN4) in samples from serum, plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.
Rat Matrilin 4 ELISA Kit (MATN4)
RK03804 96 Tests
EUR 521
Rat Matrilin 4 (MATN4) CLIA Kit
20-abx496521
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
ELISA kit for Rat MATN4 (Matrilin 4)
ELK7801 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Matrilin 4 (MATN4). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Matrilin 4 (MAT
  • Show more
Description: A sandwich ELISA kit for detection of Matrilin 4 from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Matrilin 4 (MATN4) Antibody
20-abx005982
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Matrilin 4 (MATN4) Antibody
20-abx212006
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Matrilin 4 (MATN4) Antibody
20-abx212315
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Matrilin 4 (MATN4) Antibody
20-abx317011
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Human Matrilin- 4, MATN4 ELISA KIT
ELI-15735h 96 Tests
EUR 824
Mouse Matrilin- 4, Matn4 ELISA KIT
ELI-19576m 96 Tests
EUR 865
Human Matrilin 4(MATN4)ELISA Kit
QY-E02132 96T
EUR 361
ELISA kit for Mouse Matrilin-4 (MATN4)
KTE71111-48T 48T
EUR 332
  • MATN4 encodes a member of von Willebrand factor A domain containing protein family. The proteins of this family are thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues. The specific functi
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Matrilin-4 (MATN4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Mouse Matrilin-4 (MATN4)
KTE71111-5platesof96wells 5 plates of 96 wells
EUR 2115
  • MATN4 encodes a member of von Willebrand factor A domain containing protein family. The proteins of this family are thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues. The specific functi
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Matrilin-4 (MATN4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Mouse Matrilin-4 (MATN4)
KTE71111-96T 96T
EUR 539
  • MATN4 encodes a member of von Willebrand factor A domain containing protein family. The proteins of this family are thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues. The specific functi
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Matrilin-4 (MATN4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Matrilin-4 (MATN4)
KTE61709-48T 48T
EUR 332
  • MATN4 encodes a member of von Willebrand factor A domain containing protein family. The proteins of this family are thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues. The specific functi
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Matrilin-4 (MATN4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Matrilin-4 (MATN4)
KTE61709-5platesof96wells 5 plates of 96 wells
EUR 2115
  • MATN4 encodes a member of von Willebrand factor A domain containing protein family. The proteins of this family are thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues. The specific functi
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Matrilin-4 (MATN4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Matrilin-4 (MATN4)
KTE61709-96T 96T
EUR 539
  • MATN4 encodes a member of von Willebrand factor A domain containing protein family. The proteins of this family are thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues. The specific functi
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Matrilin-4 (MATN4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Matrilin 4 (MATN4) Antibody (HRP)
20-abx317012
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Matrilin 4 (MATN4) Antibody (FITC)
20-abx317013
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Matrilin 4 (MATN4) Antibody (Biotin)
20-abx317014
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Rat Matrilin-4 PicoKine ELISA Kit
EK2031 96 wells
EUR 425
Description: For quantitative detection of rat Matrilin-4 in cell culture supernates, serum and plasma (heparin, EDTA).
Mouse Matrilin-4 PicoKine ELISA Kit
EK2030 96 wells
EUR 425
Description: For quantitative detection of mouse Matrilin-4 in cell culture supernates, serum and plasma (heparin, EDTA).
Human Matrilin 2 (Matrilin 2) ELISA Kit
abx259685-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Rat Matrilin-3 PicoKine ELISA Kit
EK2024 96 wells
EUR 425
Description: For quantitative detection of rat Matrilin-3 in cell culture supernates, serum and plasma (heparin, EDTA).
Matrilin 2 ELISA KIT|Human
EF010853 96 Tests
EUR 689
Matrilin 2 (Matrilin 2) Antibody
abx235031-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
MATN4 Recombinant Protein (Rat)
RP210965 100 ug Ask for price
Liver Dissociation System 4 (Hepatocytes, rat), Rat
4-20304 ea Ask for price
Matrilin-1
MO15126 100 ug
EUR 396
MATN4 Antibody
24870-100ul 100ul
EUR 390
MATN4 Antibody
35810-100ul 100ul
EUR 252
MATN4 Antibody
1-CSB-PA042030
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MATN4. Recognizes MATN4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:5000, WB:1:200-1:1000
MATN4 Antibody
1-CSB-PA202607
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MATN4. Recognizes MATN4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000
MATN4 Antibody
1-CSB-PA013523LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MATN4. Recognizes MATN4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA
MATN4 siRNA
20-abx923626
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
MATN4 siRNA
20-abx923627
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
Mouse Matrilin 2 (MATN2) ELISA Kit
DLR-MATN2-Mu-48T 48T
EUR 527
  • Should the Mouse Matrilin 2 (MATN2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Matrilin 2 (MATN2) in samples from tissue homogenates, cell lysates or other biological fluids.
Mouse Matrilin 2 (MATN2) ELISA Kit
DLR-MATN2-Mu-96T 96T
EUR 688
  • Should the Mouse Matrilin 2 (MATN2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Matrilin 2 (MATN2) in samples from tissue homogenates, cell lysates or other biological fluids.
Mouse Matrilin 2 (MATN2) ELISA Kit
20-abx154358
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Matrilin-2 PicoKine ELISA Kit
EK2020 96 wells
EUR 425
Description: For quantitative detection of human Matrilin-2 in cell culture supernates, serum and plasma (heparin, EDTA).
Mouse Matrilin-2 PicoKine ELISA Kit
EK2021 96 wells
EUR 425
Description: For quantitative detection of mouse Matrilin-2 in cell culture supernates, serum and plasma (heparin, EDTA).
Human Matrilin-3 PicoKine ELISA Kit
EK2022 96 wells
EUR 425
Description: For quantitative detection of human Matrilin-3 in cell culture supernates, serum and plasma (heparin, EDTA).
Mouse Matrilin-3 PicoKine ELISA Kit
EK2023 96 wells
EUR 425
Description: For quantitative detection of mouse Matrilin-3 in cell culture supernates, serum and plasma (heparin, EDTA).
Human Matrilin- 2, MATN2 ELISA KIT
ELI-19573h 96 Tests
EUR 824
Human Matrilin- 3, MATN3 ELISA KIT
ELI-19574h 96 Tests
EUR 824
Mouse Matrilin- 3, Matn3 ELISA KIT
ELI-19575m 96 Tests
EUR 865
Chicken Matrilin- 3, MATN3 ELISA KIT
ELI-23709c 96 Tests
EUR 928
Mouse Matrilin- 2, Matn2 ELISA KIT
ELI-31478m 96 Tests
EUR 865
Human Matrilin 3(MATN3)ELISA Kit
QY-E02133 96T
EUR 361
Human Matrilin 2(MATN2)ELISA Kit
QY-E02134 96T
EUR 361
Human Matrilin 1(MATN1)ELISA Kit
QY-E02135 96T
EUR 361
Mouse Matrilin 2 (MATN2) ELISA Kit
SEE149Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Matrilin 2 (MATN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Matrilin 2 (MATN2) in tissue homogenates, cell lysates and other biological fluids.
Mouse Matrilin 2 (MATN2) ELISA Kit
SEE149Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Matrilin 2 (MATN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Matrilin 2 (MATN2) in tissue homogenates, cell lysates and other biological fluids.
Mouse Matrilin 2 (MATN2) ELISA Kit
SEE149Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Matrilin 2 (MATN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Matrilin 2 (MATN2) in tissue homogenates, cell lysates and other biological fluids.
Mouse Matrilin 2 (MATN2) ELISA Kit
SEE149Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Matrilin 2 (MATN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Matrilin 2 (MATN2) in tissue homogenates, cell lysates and other biological fluids.
Mouse Matrilin 2 (MATN2) ELISA Kit
4-SEE149Mu
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Matrilin 2 elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Matrilin 2 (MATN2) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.
Mouse Matrilin 2 (MATN2) ELISA Kit
RDR-MATN2-Mu-48Tests 48 Tests
EUR 557
Mouse Matrilin 2 (MATN2) ELISA Kit
RDR-MATN2-Mu-96Tests 96 Tests
EUR 774
Mouse Matrilin 2 (MATN2) ELISA Kit
RD-MATN2-Mu-48Tests 48 Tests
EUR 533
Mouse Matrilin 2 (MATN2) ELISA Kit
RD-MATN2-Mu-96Tests 96 Tests
EUR 740
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202
Rat FibrOut 4, for brain, neural
4-20533 1 ml Ask for price
Rat FibrOut 4, for brain, neural
4-20534 5 x 1 ml Ask for price
Matn4 ORF Vector (Rat) (pORF)
ORF070323 1.0 ug DNA
EUR 506
Thymus Dissociation System 4 (Epithelial), Adult rat
4-20444 ea Ask for price
ELISA kit for Mouse MATN2 (Matrilin 2)
ELK6429 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Matrilin 2 (MATN2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Matrilin 2 (MAT
  • Show more
Description: A sandwich ELISA kit for detection of Matrilin 2 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
ELISA kit for Mouse Matrilin-3 (MATN3)
KTE71112-48T 48T
EUR 332
  • Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Matrilin-3 (MATN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Mouse Matrilin-3 (MATN3)
KTE71112-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Matrilin-3 (MATN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Mouse Matrilin-3 (MATN3)
KTE71112-96T 96T
EUR 539
  • Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Matrilin-3 (MATN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Mouse Matrilin-2 (MATN2)
KTE71384-48T 48T
EUR 332
  • Matrilin-2 is a member of the von Willebrand factor A domain containing protein family. This family of proteins is thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues.The specific function
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Matrilin-2 (MATN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Mouse Matrilin-2 (MATN2)
KTE71384-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Matrilin-2 is a member of the von Willebrand factor A domain containing protein family. This family of proteins is thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues.The specific function
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Matrilin-2 (MATN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Mouse Matrilin-2 (MATN2)
KTE71384-96T 96T
EUR 539
  • Matrilin-2 is a member of the von Willebrand factor A domain containing protein family. This family of proteins is thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues.The specific function
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Matrilin-2 (MATN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Matrilin-3 (MATN3)
KTE61710-48T 48T
EUR 332
  • Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Matrilin-3 (MATN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Matrilin-3 (MATN3)
KTE61710-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Matrilin-3 (MATN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Matrilin-3 (MATN3)
KTE61710-96T 96T
EUR 539
  • Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Matrilin-3 (MATN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Matrilin-2 (MATN2)
KTE61711-48T 48T
EUR 332
  • Matrilin-2 is a member of the von Willebrand factor A domain containing protein family. This family of proteins is thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues.The specific function
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Matrilin-2 (MATN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Matrilin-2 (MATN2)
KTE61711-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Matrilin-2 is a member of the von Willebrand factor A domain containing protein family. This family of proteins is thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues.The specific function
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Matrilin-2 (MATN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Matrilin-2 (MATN2)
KTE61711-96T 96T
EUR 539
  • Matrilin-2 is a member of the von Willebrand factor A domain containing protein family. This family of proteins is thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues.The specific function
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Matrilin-2 (MATN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Chicken Matrilin-3 (MATN3)
KTE30122-48T 48T
EUR 354
  • Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
  • Show more
Description: Quantitative sandwich ELISA for measuring Chicken Matrilin-3 (MATN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Chicken Matrilin-3 (MATN3)
KTE30122-5platesof96wells 5 plates of 96 wells
EUR 2252
  • Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
  • Show more
Description: Quantitative sandwich ELISA for measuring Chicken Matrilin-3 (MATN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Chicken Matrilin-3 (MATN3)
KTE30122-96T 96T
EUR 572
  • Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
  • Show more
Description: Quantitative sandwich ELISA for measuring Chicken Matrilin-3 (MATN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Cartilage Dissociation System 4 (Chondrocytes), Mouse and Rat
4-20234 ea Ask for price
Pancreas Dissociation System 4 (Islets), Mouse and Rat
4-20374 ea Ask for price
Skin Dissociation System 4 (Keratinocytes), Mouse and Rat
4-20434 ea Ask for price
Matrilin 2 antibody
70R-12133 100 ug
EUR 403
Description: Rabbit polyclonal Matrilin 2 antibody
Matrilin 2 antibody
70R-2250 50 ug
EUR 467
Description: Rabbit polyclonal Matrilin 2 antibody raised against the middle region of MATN2
Matrilin-2 Antibody
3840-100
EUR 316
Matrilin-2 Antibody
3840-30T
EUR 146
Matrilin 3 antibody
70R-5334 50 ug
EUR 467
Description: Rabbit polyclonal Matrilin 3 antibody raised against the N terminal of MATN3
Matrilin 3 antibody
70R-5335 50 ug
EUR 467
Description: Rabbit polyclonal Matrilin 3 antibody raised against the middle region of MATN3
Matrilin 1 antibody
70R-5353 50 ug
EUR 467
Description: Rabbit polyclonal Matrilin 1 antibody raised against the middle region of MATN1
anti-Matrilin 2
YF-PA13069 50 ug
EUR 363
Description: Mouse polyclonal to Matrilin 2
anti-Matrilin 2
YF-PA13070 100 ug
EUR 403
Description: Rabbit polyclonal to Matrilin 2
anti-Matrilin 2
YF-PA24122 50 ul
EUR 334
Description: Mouse polyclonal to Matrilin 2
Polyclonal MATN4 Antibody
APR17343G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MATN4 . This antibody is tested and proven to work in the following applications:
MATN4 Conjugated Antibody
C35810 100ul
EUR 397
MATN4 cloning plasmid
CSB-CL013523HU1-10ug 10ug
EUR 565
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1623
  • Sequence: ATGAGAGGCCTTCTTTGCTGGCCCGTGTTGCTGCTCCTTCTTCAGCCCTGGGAAACCCAGCTCCAGTTGACAGGTCCCAGGTGTCACACTGGGCCCCTGGATCTGGTGTTCGTGATTGACAGCTCCCGCAGCGTGCGCCCTTTCGAGTTCGAGACCATGCGGCAGTTCCTCATGG
  • Show more
Description: A cloning plasmid for the MATN4 gene.
MATN4 cloning plasmid
CSB-CL013523HU2-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1746
  • Sequence: ATGAGAGGCCTTCTTTGCTGGCCCGTGTTGCTGCTCCTTCTTCAGCCCTGGGAAACCCAGCTCCAGTTGACAGGTCCCAGGTGTCACACTGGGCCCCTGGATCTGGTGTTCGTGATTGACAGCTCCCGCAGCGTGCGCCCTTTCGAGTTCGAGACCATGCGGCAGTTCCTCATGG
  • Show more
Description: A cloning plasmid for the MATN4 gene.
MATN4 Rabbit pAb
A2761-100ul 100 ul
EUR 308
MATN4 Rabbit pAb
A2761-200ul 200 ul
EUR 459
MATN4 Rabbit pAb
A2761-20ul 20 ul
EUR 183
MATN4 Rabbit pAb
A2761-50ul 50 ul
EUR 223
MATN4 Polyclonal Antibody
ABP59229-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human MATN4 protein at amino acid sequence of 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of MATN4 from Human, Mouse. This MATN4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MATN4 protein at amino acid sequence of 30-110
MATN4 Polyclonal Antibody
ABP59229-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human MATN4 protein at amino acid sequence of 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of MATN4 from Human, Mouse. This MATN4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MATN4 protein at amino acid sequence of 30-110
MATN4 Polyclonal Antibody
ABP59229-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human MATN4 protein at amino acid sequence of 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of MATN4 from Human, Mouse. This MATN4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MATN4 protein at amino acid sequence of 30-110
MATN4 Polyclonal Antibody
ES11212-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MATN4 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
MATN4 Polyclonal Antibody
ES11212-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MATN4 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
Anti-MATN4 antibody
STJ24506 100 µl
EUR 277
Description: This gene encodes a member of von Willebrand factor A domain-containing protein family. The proteins of this family are thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues. This family member is thought to be play a role in reorganizing and regenerating the corneal matrix in granular and lattice type I dystrophies. It may also be involved in wound healing in the dentin-pulp complex. Alternative splicing results in multiple transcript variants.
Anti-MATN4 antibody
STJ192370 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to MATN4
IL-4 Interleukin 4 Human Recombinant Protein, Yeast
PROTP05112-4 Regular: 10ug
EUR 317
Description: Interleukin-4 Human Recombinant produced in yeast is a single, glycosylated polypeptide chain containing 129 amino acids.;The IL-4 is purified by proprietary chromatographic techniques.
Custom production of antibodies in 5 Rats using customer supplied antigen (std 63 days protocol)
RAT-5 1
EUR 1138
Adipose/Fat Dissociation System 4 (Predipocytes), Mouse and Rat
4-20194 ea Ask for price
Brain Dissociation System 4 (Endothelial, Microvessels), Mouse and Rat
4-20224 ea Ask for price
Endothelial Dissociation System 4 (Endothelial,Cerebral), Mouse and Rat
4-20244 ea Ask for price
Heart Dissociation System 4 (Myocytes,Ventricles), Mouse and Rat
4-20274 ea Ask for price
Muscle Dissociation System 4 (Smooth muscle), Mouse and Rat
4-20334 ea Ask for price
Parotid Dissociation System 4 (Parotid acinar), Mouse and Rat
4-20394 ea Ask for price
Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit
DLR-CA72-4-Hu-48T 48T
EUR 479
  • Should the Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Carbohydrate Antigen 72-4 (CA72-4) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit
DLR-CA72-4-Hu-96T 96T
EUR 621
  • Should the Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Carbohydrate Antigen 72-4 (CA72-4) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit
RDR-CA72-4-Hu-48Tests 48 Tests
EUR 500
Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit
RDR-CA72-4-Hu-96Tests 96 Tests
EUR 692
Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit
RD-CA72-4-Hu-48Tests 48 Tests
EUR 478
Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit
RD-CA72-4-Hu-96Tests 96 Tests
EUR 662
Matn4 sgRNA CRISPR Lentivector set (Rat)
K6374101 3 x 1.0 ug
EUR 339
Epithelial Dissociation System 4 (Epithelial,Submandibular salivary), Mouse and Rat
4-20254 ea Ask for price
Heart Dissociation System 4 (Retinal pigment epithelial), Mouse and Rat
4-20294 ea Ask for price
Lung Dissociation System 4 (Alveolar type II), Mouse and Rat
4-20314 ea Ask for price
Reproductive Tissue Dissociation System 4 (Epithelial, vagina), Mouse and Rat
4-20414 ea Ask for price
Individual Reaction Mix 4
G065-4 200 reactions
EUR 167
Mouse Matrilin 2 (MATN2) CLIA Kit
20-abx494521
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Frit Kit
FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.
Adrenal Dissociation System 4 (Heart, Adrenal chromaffin, Paraneurons), Mouse and Rat
4-20204 ea Ask for price
Kidney Dissociation System 4 (Inner medullary duct,Papillae), Mouse and Rat
4-29294 ea Ask for price
Matrilin 3 Blocking Peptide
33R-3946 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MATN3 antibody, catalog no. 70R-5335
Matrilin 1 Blocking Peptide
33R-4743 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MATN1 antibody, catalog no. 70R-5353
Matrilin 2 Blocking Peptide
33R-10950 50 ug
EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Matrilin 2 antibody, catalog no. 70R-12133
Matrilin 3 Blocking Peptide
33R-1471 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MATN3 antibody, catalog no. 70R-5334
Matrilin 2 Blocking Peptide
33R-1598 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MATN2 antibody, catalog no. 70R-2250
Matrilin-2 Blocking Peptide
3840BP-50
EUR 153
Matrilin 3 (MATN3) Antibody
20-abx006513
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Matrilin 1 (MATN1) Antibody
abx027038-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Matrilin 1 (MATN1) Antibody
abx027038-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Rat MATN4(Matrilin 4) ELISA Kit