Rat NPFF(Neuropeptide FF) ELISA Kit
To Order Contact us: [email protected]
Mouse Neuropeptide FF (NPFF) ELISA Kit |
DLR-NPFF-Mu-48T |
DL Develop |
48T |
EUR 527 |
- Should the Mouse Neuropeptide FF (NPFF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse Neuropeptide FF (NPFF) in samples from urine, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Mouse Neuropeptide FF (NPFF) ELISA Kit |
DLR-NPFF-Mu-96T |
DL Develop |
96T |
EUR 688 |
- Should the Mouse Neuropeptide FF (NPFF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse Neuropeptide FF (NPFF) in samples from urine, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Neuropeptide FF (NPFF) ELISA Kit |
RD-NPFF-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Neuropeptide FF (NPFF) ELISA Kit |
RD-NPFF-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Mouse Neuropeptide FF (NPFF) ELISA Kit |
RD-NPFF-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 533 |
Mouse Neuropeptide FF (NPFF) ELISA Kit |
RD-NPFF-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 740 |
Human Neuropeptide FF (NPFF) ELISA Kit |
RDR-NPFF-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Neuropeptide FF (NPFF) ELISA Kit |
RDR-NPFF-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Mouse Neuropeptide FF (NPFF) ELISA Kit |
RDR-NPFF-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Mouse Neuropeptide FF (NPFF) ELISA Kit |
RDR-NPFF-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 774 |
Rat Neuropeptide FF (NPFF) ELISA Kit |
CEG003Ra-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5124.2 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Neuropeptide FF (NPFF) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Neuropeptide FF (NPFF) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Rat Neuropeptide FF (NPFF) ELISA Kit |
CEG003Ra-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 509.64 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Neuropeptide FF (NPFF) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Neuropeptide FF (NPFF) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Rat Neuropeptide FF (NPFF) ELISA Kit |
CEG003Ra-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 685.2 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Neuropeptide FF (NPFF) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Neuropeptide FF (NPFF) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Rat Neuropeptide FF (NPFF) ELISA Kit |
CEG003Ra-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2783.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Neuropeptide FF (NPFF) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Neuropeptide FF (NPFF) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Rat Neuropeptide FF (NPFF) ELISA Kit |
4-CEG003Ra |
Cloud-Clone |
-
EUR 5175.00
-
EUR 2734.00
-
EUR 686.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Neuropeptide FF elisa. Alternative names of the recognized antigen: FMRFAL
- Neuropeptide FF-Amide Peptide Precursor
- Pro-FMRFamide-related neuropeptide FF
|
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Rat Neuropeptide FF (NPFF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Rat Neuropeptide FF (NPFF) ELISA Kit |
20-abx258952 |
Abbexa |
-
EUR 7237.00
-
EUR 3855.00
-
EUR 895.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Neuropeptide FF (NPFF) Antibody |
20-abx132224 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1302.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Neuropeptide FF (NPFF) Antibody |
abx032457-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Neuropeptide FF (NPFF) Antibody |
abx032457-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Neuropeptide FF (NPFF) Antibody |
20-abx006415 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Neuropeptide FF (NPFF) Antibody |
20-abx173787 |
Abbexa |
|
|
|
Neuropeptide FF (NPFF) Antibody |
20-abx177768 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Neuropeptide FF (NPFF) Antibody |
20-abx177769 |
Abbexa |
|
|
|
Neuropeptide FF (NPFF) Antibody |
20-abx177770 |
Abbexa |
-
EUR 439.00
-
EUR 133.00
-
EUR 1233.00
-
EUR 592.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Neuropeptide FF (NPFF) Antibody |
20-abx320780 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Recombinant Neuropeptide FF (NPFF) |
4-RPG003Mu01 |
Cloud-Clone |
-
EUR 485.28
-
EUR 233.00
-
EUR 1544.80
-
EUR 581.60
-
EUR 1063.20
-
EUR 388.00
-
EUR 3712.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q9WVA8
- Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 41.3kDa
- Isoelectric Point: 9.5
|
Description: Recombinant Mouse Neuropeptide FF expressed in: E.coli |
Rat Neuropeptide FF (NPFF) CLIA Kit |
20-abx490636 |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
ELISA kit for Rat NPFF (Neuropeptide FF) |
ELK7704 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- A monoclonal antibody specific to Neuropeptide FF (NPFF) has been pre-coated onto a microplate. A competitive inhibition reaction is launched between biotin labeled Neuropeptide FF (NPFF) and unlabeled Neuropeptide FF (NPFF) (Standards or samples) wi
- Show more
|
Description: A competitive Inhibition ELISA kit for detection of Neuropeptide FF from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Human Neuropeptide FF (NPFF) ELISA Kit |
CEG003Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neuropeptide FF (NPFF) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Neuropeptide FF (NPFF) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Neuropeptide FF (NPFF) ELISA Kit |
CEG003Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neuropeptide FF (NPFF) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Neuropeptide FF (NPFF) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Neuropeptide FF (NPFF) ELISA Kit |
CEG003Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neuropeptide FF (NPFF) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Neuropeptide FF (NPFF) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Neuropeptide FF (NPFF) ELISA Kit |
CEG003Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neuropeptide FF (NPFF) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Neuropeptide FF (NPFF) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Neuropeptide FF (NPFF) ELISA Kit |
4-CEG003Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Neuropeptide FF elisa. Alternative names of the recognized antigen: FMRFAL
- Neuropeptide FF-Amide Peptide Precursor
- Pro-FMRFamide-related neuropeptide FF
|
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Neuropeptide FF (NPFF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Mouse Neuropeptide FF (NPFF) ELISA Kit |
CEG003Mu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4862.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Neuropeptide FF (NPFF) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Mouse Neuropeptide FF (NPFF) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Mouse Neuropeptide FF (NPFF) ELISA Kit |
CEG003Mu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 488.08 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Neuropeptide FF (NPFF) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Mouse Neuropeptide FF (NPFF) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Mouse Neuropeptide FF (NPFF) ELISA Kit |
CEG003Mu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 654.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Neuropeptide FF (NPFF) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Mouse Neuropeptide FF (NPFF) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Mouse Neuropeptide FF (NPFF) ELISA Kit |
CEG003Mu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2644.8 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Neuropeptide FF (NPFF) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Mouse Neuropeptide FF (NPFF) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Mouse Neuropeptide FF (NPFF) ELISA Kit |
4-CEG003Mu |
Cloud-Clone |
-
EUR 4913.00
-
EUR 2595.00
-
EUR 655.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Neuropeptide FF elisa. Alternative names of the recognized antigen: FMRFAL
- Neuropeptide FF-Amide Peptide Precursor
- Pro-FMRFamide-related neuropeptide FF
|
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Mouse Neuropeptide FF (NPFF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Mouse Neuropeptide FF (NPFF) ELISA Kit |
20-abx154455 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Neuropeptide FF (NPFF) ELISA Kit |
20-abx152503 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Neuropeptide FF ELISA Kit (NPFF) |
RK01954 |
Abclonal |
96 Tests |
EUR 521 |
Mouse Neuropeptide FF ELISA Kit (NPFF) |
RK03071 |
Abclonal |
96 Tests |
EUR 521 |
Rat Neuropeptide FF (NPFF) Peptide (OVA) |
20-abx651249 |
Abbexa |
-
EUR 272.00
-
EUR 189.00
-
EUR 606.00
-
EUR 300.00
-
EUR 230.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Neuropeptide FF (NPFF) Polyclonal Antibody (Rat) |
4-PAG003Ra08 |
Cloud-Clone |
-
EUR 259.00
-
EUR 2708.00
-
EUR 670.00
-
EUR 328.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CPG003Ra21-OVA Conjugated Neuropeptide FF (NPFF)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Neuropeptide FF (NPFF) |
Human Neuropeptide FF (NPFF) Protein |
20-abx654526 |
Abbexa |
-
EUR 662.00
-
EUR 272.00
-
EUR 2026.00
-
EUR 787.00
-
EUR 481.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Mouse Neuropeptide FF (NPFF) Peptide |
20-abx652235 |
Abbexa |
-
EUR 676.00
-
EUR 286.00
-
EUR 2082.00
-
EUR 801.00
-
EUR 481.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
OVA Conjugated Neuropeptide FF (NPFF) |
4-CPG003Hu21 |
Cloud-Clone |
-
EUR 187.81
-
EUR 153.00
-
EUR 429.28
-
EUR 209.76
-
EUR 319.52
-
EUR 188.00
-
EUR 923.20
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: O15130
- Buffer composition: PBS, pH 7.4.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): Inquire
- Isoelectric Point: Inquire
|
Description: Recombinant Human Neuropeptide FF expressed in: chemical synthesis |
OVA Conjugated Neuropeptide FF (NPFF) |
4-CPG003Mu21 |
Cloud-Clone |
-
EUR 187.81
-
EUR 153.00
-
EUR 429.28
-
EUR 209.76
-
EUR 319.52
-
EUR 188.00
-
EUR 923.20
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q9WVA8
- Buffer composition: PBS, pH 7.4.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): Inquire
- Isoelectric Point: Inquire
|
Description: Recombinant Mouse Neuropeptide FF expressed in: chemical synthesis |
OVA Conjugated Neuropeptide FF (NPFF) |
4-CPG003Ra21 |
Cloud-Clone |
-
EUR 187.81
-
EUR 153.00
-
EUR 429.28
-
EUR 209.76
-
EUR 319.52
-
EUR 188.00
-
EUR 923.20
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q9WVA9
- Buffer composition: PBS, pH 7.4.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): Inquire
- Isoelectric Point: Inquire
|
Description: Recombinant Rat Neuropeptide FF expressed in: chemical synthesis |
Human Neuropeptide FF (NPFF) CLIA Kit |
20-abx490520 |
Abbexa |
-
EUR 7911.00
-
EUR 4215.00
-
EUR 973.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Mouse Neuropeptide FF (NPFF) CLIA Kit |
20-abx490521 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
ELISA kit for Human NPFF (Neuropeptide FF) |
ELK3724 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- A monoclonal antibody specific to Neuropeptide FF (NPFF) has been pre-coated onto a microplate. A competitive inhibition reaction is launched between biotin labeled Neuropeptide FF (NPFF) and unlabeled Neuropeptide FF (NPFF) (Standards or samples) wi
- Show more
|
Description: A competitive Inhibition ELISA kit for detection of Neuropeptide FF from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Mouse NPFF (Neuropeptide FF) |
ELK6090 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- A monoclonal antibody specific to Neuropeptide FF (NPFF) has been pre-coated onto a microplate. A competitive inhibition reaction is launched between biotin labeled Neuropeptide FF (NPFF) and unlabeled Neuropeptide FF (NPFF) (Standards or samples) wi
- Show more
|
Description: A competitive Inhibition ELISA kit for detection of Neuropeptide FF from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Neuropeptide FF (NPFF) Polyclonal Antibody (Rat), APC |
4-PAG003Ra08-APC |
Cloud-Clone |
-
EUR 364.00
-
EUR 3545.00
-
EUR 980.00
-
EUR 467.00
-
EUR 227.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CPG003Ra21-OVA Conjugated Neuropeptide FF (NPFF)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Neuropeptide FF (NPFF). This antibody is labeled with APC. |
Neuropeptide FF (NPFF) Polyclonal Antibody (Rat), Biotinylated |
4-PAG003Ra08-Biotin |
Cloud-Clone |
-
EUR 325.00
-
EUR 2658.00
-
EUR 777.00
-
EUR 400.00
-
EUR 225.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CPG003Ra21-OVA Conjugated Neuropeptide FF (NPFF)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Neuropeptide FF (NPFF). This antibody is labeled with Biotin. |
Neuropeptide FF (NPFF) Polyclonal Antibody (Rat), Cy3 |
4-PAG003Ra08-Cy3 |
Cloud-Clone |
-
EUR 444.00
-
EUR 4685.00
-
EUR 1265.00
-
EUR 581.00
-
EUR 261.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CPG003Ra21-OVA Conjugated Neuropeptide FF (NPFF)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Neuropeptide FF (NPFF). This antibody is labeled with Cy3. |
Neuropeptide FF (NPFF) Polyclonal Antibody (Rat), FITC |
4-PAG003Ra08-FITC |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CPG003Ra21-OVA Conjugated Neuropeptide FF (NPFF)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Neuropeptide FF (NPFF). This antibody is labeled with FITC. |
Neuropeptide FF (NPFF) Polyclonal Antibody (Rat), HRP |
4-PAG003Ra08-HRP |
Cloud-Clone |
-
EUR 332.00
-
EUR 3089.00
-
EUR 866.00
-
EUR 421.00
-
EUR 213.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CPG003Ra21-OVA Conjugated Neuropeptide FF (NPFF)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Neuropeptide FF (NPFF). This antibody is labeled with HRP. |
Neuropeptide FF (NPFF) Polyclonal Antibody (Rat), PE |
4-PAG003Ra08-PE |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CPG003Ra21-OVA Conjugated Neuropeptide FF (NPFF)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Neuropeptide FF (NPFF). This antibody is labeled with PE. |
Human Neuropeptide FF (NPFF) Peptide (OVA) |
20-abx651247 |
Abbexa |
-
EUR 272.00
-
EUR 189.00
-
EUR 606.00
-
EUR 300.00
-
EUR 230.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Mouse Neuropeptide FF (NPFF) Peptide (OVA) |
20-abx651248 |
Abbexa |
-
EUR 272.00
-
EUR 189.00
-
EUR 606.00
-
EUR 300.00
-
EUR 230.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Npff ELISA Kit| Rat Pro-FMRFamide-related neuropeptide FF ELISA |
EF019060 |
Lifescience Market |
96 Tests |
EUR 689 |
Neuropeptide FF (NPFF) Polyclonal Antibody (Rat), APC-Cy7 |
4-PAG003Ra08-APC-Cy7 |
Cloud-Clone |
-
EUR 608.00
-
EUR 6970.00
-
EUR 1840.00
-
EUR 814.00
-
EUR 335.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CPG003Ra21-OVA Conjugated Neuropeptide FF (NPFF)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Neuropeptide FF (NPFF). This antibody is labeled with APC-Cy7. |
Npff ELISA Kit| Mouse Pro-FMRFamide-related neuropeptide FF ELI |
EF015671 |
Lifescience Market |
96 Tests |
EUR 689 |
NPFF ELISA Kit| Bovine Pro-FMRFamide-related neuropeptide FF EL |
EF011662 |
Lifescience Market |
96 Tests |
EUR 689 |
Neuropeptide FF |
B5386-1 |
ApexBio |
1 mg |
EUR 224 |
Neuropeptide FF |
H-5655.0001 |
Bachem |
1.0mg |
EUR 176 |
Description: Sum Formula: C54H76N14O10; CAS# [99566-27-5] |
Neuropeptide FF |
H-5655.0005 |
Bachem |
5.0mg |
EUR 611 |
Description: Sum Formula: C54H76N14O10; CAS# [99566-27-5] |
Rat Neuropeptide FF receptor 2 (NPFFR2) ELISA Kit |
abx515900-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
Rat Npffr2/ Neuropeptide FF receptor 2 ELISA Kit |
E0684Ra |
Sunlong |
1 Kit |
EUR 646 |
Npffr2 ELISA Kit| Rat Neuropeptide FF receptor 2 ELISA Kit |
EF019059 |
Lifescience Market |
96 Tests |
EUR 689 |
Mouse Neuropeptide FF receptor 2 (NPFFR2) ELISA Kit |
abx515899-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
ELISA kit for Human Neuropeptide FF receptor 2 |
EK3014 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Neuropeptide FF receptor 2 in samples from serum, plasma, tissue homogenates and other biological fluids. |
Human NPFFR2/ Neuropeptide FF receptor 2 ELISA Kit |
E1773Hu |
Sunlong |
1 Kit |
EUR 605 |
Human NPFFR2(Neuropeptide FF receptor 2) ELISA Kit |
EH1402 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.625-40 ng/ml
- Uniprot ID: Q9Y5X5
- Alias: NPFFR2/Neuropeptide FF receptor 2/Neuropeptide G-protein coupled receptor/G-protein coupled receptor 74/G-protein coupled receptor HLWAR77
|
Description: Method of detection: Coated with Antigen, Competitive ELISA;Reacts with: Homo sapiens;Sensitivity: 0.375 ng/ml |
Human Neuropeptide FF receptor 1, NPFFR1 ELISA KIT |
ELI-13105h |
Lifescience Market |
96 Tests |
EUR 824 |
Mouse Neuropeptide FF receptor 2, Npffr2 ELISA KIT |
ELI-13106m |
Lifescience Market |
96 Tests |
EUR 865 |
Human Neuropeptide FF receptor 2, NPFFR2 ELISA KIT |
ELI-22247h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Neuropeptide FF receptor 2 (NPFFR2) ELISA Kit |
abx250677-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Npffr2 ELISA Kit| Mouse Neuropeptide FF receptor 2 ELISA Kit |
EF015670 |
Lifescience Market |
96 Tests |
EUR 689 |
Neuropeptide FF Receptor 2 (NPFFR2) Antibody |
abx027655-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Neuropeptide FF Receptor 2 (NPFFR2) Antibody |
abx027655-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Neuropeptide FF Receptor 1 (NPFFR1) Antibody |
abx027869-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Neuropeptide FF Receptor 1 (NPFFR1) Antibody |
abx027869-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Neuropeptide FF Receptor 1 (NPFFR1) Antibody |
abx433057-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Neuropeptide FF Receptor 2 (NPFFR2) Antibody |
abx235815-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
Human Neuropeptide FF receptor 2 (NPFFR2) |
1-CSB-YP015983HU |
Cusabio |
-
EUR 430.00
-
EUR 234.00
-
EUR 1508.00
-
EUR 642.00
-
EUR 1009.00
-
EUR 291.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 50.7 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Neuropeptide FF receptor 2(NPFFR2) expressed in Yeast |
Recombinant human Neuropeptide FF receptor 2 |
P1899 |
FN Test |
100ug |
Ask for price |
- Uniprot ID: Q9Y5X5
- Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
|
Description: Recombinant protein for human Neuropeptide FF receptor 2 |
Neuropeptide FF Morphine Modulating Neuropeptide F-8-F-NH2 |
20-abx266130 |
Abbexa |
-
EUR 411.00
-
EUR 662.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Neuropeptide FF Morphine Modulating Neuropeptide F-8-F-NH2 |
5-01611 |
CHI Scientific |
4 x 5mg |
Ask for price |
(D-Tyr1,N-Me-Phe3)-Neuropeptide FF |
H-4752.0001 |
Bachem |
1.0mg |
EUR 466 |
Description: Sum Formula: C55H78N14O11; CAS# [145274-93-7] net |
(D-Tyr1,N-Me-Phe3)-Neuropeptide FF |
H-4752.0005 |
Bachem |
5.0mg |
EUR 1772 |
Description: Sum Formula: C55H78N14O11; CAS# [145274-93-7] net |
Recombinant Human Neuropeptide FF receptor 2 Protein, His, Yeast-100ug |
QP9310-ye-100ug |
EnQuireBio |
100ug |
EUR 480 |
Recombinant Human Neuropeptide FF receptor 2 Protein, His, Yeast-10ug |
QP9310-ye-10ug |
EnQuireBio |
10ug |
EUR 236 |
Recombinant Human Neuropeptide FF receptor 2 Protein, His, Yeast-1mg |
QP9310-ye-1mg |
EnQuireBio |
1mg |
EUR 1885 |
Recombinant Human Neuropeptide FF receptor 2 Protein, His, Yeast-200ug |
QP9310-ye-200ug |
EnQuireBio |
200ug |
EUR 744 |
Recombinant Human Neuropeptide FF receptor 2 Protein, His, Yeast-500ug |
QP9310-ye-500ug |
EnQuireBio |
500ug |
EUR 1206 |
Recombinant Human Neuropeptide FF receptor 2 Protein, His, Yeast-50ug |
QP9310-ye-50ug |
EnQuireBio |
50ug |
EUR 299 |
Rat Neuropeptide A ELISA kit |
E02N0033-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Neuropeptide A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Neuropeptide A ELISA kit |
E02N0033-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Neuropeptide A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Neuropeptide A ELISA kit |
E02N0033-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Neuropeptide A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat NPFF shRNA Plasmid |
20-abx986017 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
NPFF Recombinant Protein (Rat) |
RP214325 |
ABM |
100 ug |
Ask for price |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
NPFF siRNA |
20-abx903617 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NPFF siRNA |
20-abx926232 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NPFF siRNA |
20-abx926233 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NPFF Antibody |
1-CSB-PA015981ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against NPFF. Recognizes NPFF from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
Rat Neuropeptide Y (NPY) ELISA Kit |
CEA879Ra-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4626.78 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Neuropeptide Y (NPY) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Neuropeptide Y (NPY) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Rat Neuropeptide Y (NPY) ELISA Kit |
CEA879Ra-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 468.68 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Neuropeptide Y (NPY) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Neuropeptide Y (NPY) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Rat Neuropeptide Y (NPY) ELISA Kit |
CEA879Ra-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 626.68 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Neuropeptide Y (NPY) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Neuropeptide Y (NPY) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Rat Neuropeptide Y (NPY) ELISA Kit |
CEA879Ra-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2520.06 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Neuropeptide Y (NPY) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Neuropeptide Y (NPY) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Rat Neuropeptide Y (NPY) ELISA Kit |
4-CEA879Ra |
Cloud-Clone |
-
EUR 4677.00
-
EUR 2471.00
-
EUR 627.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Neuropeptide Y elisa. Alternative names of the recognized antigen: NP-Y
- PYY4
- CPON
- Pro-neuropeptide Y
- Neuropeptide tyrosine
- C-flanking peptide of NPY
|
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Rat Neuropeptide Y (NPY) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Rat Neuropeptide S (NPS) ELISA Kit |
CEA796Ra-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4626.78 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Neuropeptide S (NPS) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Neuropeptide S (NPS) in serum, plasma and other biological fluids. |
Rat Neuropeptide S (NPS) ELISA Kit |
CEA796Ra-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 468.68 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Neuropeptide S (NPS) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Neuropeptide S (NPS) in serum, plasma and other biological fluids. |
Rat Neuropeptide S (NPS) ELISA Kit |
CEA796Ra-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 626.68 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Neuropeptide S (NPS) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Neuropeptide S (NPS) in serum, plasma and other biological fluids. |
Rat Neuropeptide S (NPS) ELISA Kit |
CEA796Ra-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2520.06 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Neuropeptide S (NPS) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Neuropeptide S (NPS) in serum, plasma and other biological fluids. |
Rat Neuropeptide S (NPS) ELISA Kit |
4-CEA796Ra |
Cloud-Clone |
-
EUR 4677.00
-
EUR 2471.00
-
EUR 627.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Neuropeptide S elisa. Alternative names of the recognized antigen: NP-S
|
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Rat Neuropeptide S (NPS) in samples from Serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species. |
Rat Neuropeptide S (NPS) ELISA Kit |
abx574146-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Rat Neuropeptide Y (NPY) ELISA Kit |
abx575140-96tests |
Abbexa |
96 tests |
EUR 746 |
- Shipped within 5-12 working days.
|
Rat Nps/ Neuropeptide S ELISA Kit |
E0690Ra |
Sunlong |
1 Kit |
EUR 646 |
Rat Neuropeptide W(NPW) ELISA kit |
E02N0558-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Neuropeptide W(NPW) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Neuropeptide W(NPW) ELISA kit |
E02N0558-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Neuropeptide W(NPW) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Neuropeptide W(NPW) ELISA kit |
E02N0558-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Neuropeptide W(NPW) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
ELISA kit for Rat Neuropeptide S |
EK4731 |
SAB |
96 tests |
EUR 603 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Rat Neuropeptide S in samples from serum, plasma, tissue homogenates and other biological fluids. |
Rat Nps(Neuropeptide S) ELISA Kit |
ER0673 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: P0C0P7
- Alias: Nps
|
Description: Method of detection: Coated with Antigen, Competitive ELISA;Reacts with: Rattus;Sensitivity: 0.094 ng/ml |
Rat Neuropeptide S (NPS) ELISA Kit |
20-abx155884 |
Abbexa |
-
EUR 7237.00
-
EUR 3855.00
-
EUR 895.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Rat Neuropeptide Y (NPY) ELISA Kit |
20-abx155885 |
Abbexa |
-
EUR 7237.00
-
EUR 3855.00
-
EUR 895.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Rat Neuropeptide Y (NPY) ELISA Kit |
abx256138-96tests |
Abbexa |
96 tests |
EUR 746 |
- Shipped within 5-12 working days.
|
Rat Neuropeptide S (NPS) ELISA Kit |
abx256648-96tests |
Abbexa |
96 tests |
EUR 746 |
- Shipped within 5-12 working days.
|
Rat Neuropeptide S (NPS) ELISA Kit |
DLR-NPS-Ra-48T |
DL Develop |
48T |
EUR 508 |
- Should the Rat Neuropeptide S (NPS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat Neuropeptide S (NPS) in samples from serum, plasma or other biological fluids. |
Rat Neuropeptide S (NPS) ELISA Kit |
DLR-NPS-Ra-96T |
DL Develop |
96T |
EUR 661 |
- Should the Rat Neuropeptide S (NPS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat Neuropeptide S (NPS) in samples from serum, plasma or other biological fluids. |
Rat Neuropeptide Y (NPY) ELISA Kit |
DLR-NPY-Ra-48T |
DL Develop |
48T |
EUR 508 |
- Should the Rat Neuropeptide Y (NPY) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat Neuropeptide Y (NPY) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Rat Neuropeptide Y (NPY) ELISA Kit |
DLR-NPY-Ra-96T |
DL Develop |
96T |
EUR 661 |
- Should the Rat Neuropeptide Y (NPY) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat Neuropeptide Y (NPY) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Rat Neuropeptide S(NPS) ELISA kit |
CSB-EL016026RA-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Rat Neuropeptide S (NPS) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Rat Neuropeptide S(NPS) ELISA kit |
1-CSB-EL016026RA |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Rat Neuropeptide S(NPS) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Rat neuropeptide Y (NPY) ELISA kit |
CSB-E13431r-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Rat neuropeptide Y (NPY) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Rat neuropeptide Y (NPY) ELISA kit |
1-CSB-E13431r |
Cusabio |
-
EUR 703.00
-
EUR 4843.00
-
EUR 2570.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Rat neuropeptide Y (NPY) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Rat Neuropeptide Y ELISA Kit (NPY) |
RK03847 |
Abclonal |
96 Tests |
EUR 521 |
Rat Neuropeptide S (NPS) ELISA Kit |
RD-NPS-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 511 |
Rat Neuropeptide S (NPS) ELISA Kit |
RD-NPS-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 709 |
Rat Neuropeptide Y (NPY) ELISA Kit |
RD-NPY-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 511 |
Rat Neuropeptide Y (NPY) ELISA Kit |
RD-NPY-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 709 |
Rat Neuropeptide S (NPS) ELISA Kit |
RDR-NPS-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 534 |
Rat Neuropeptide S (NPS) ELISA Kit |
RDR-NPS-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 742 |
Rat Neuropeptide Y (NPY) ELISA Kit |
RDR-NPY-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 534 |
Rat Neuropeptide Y (NPY) ELISA Kit |
RDR-NPY-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 742 |
Npff ORF Vector (Rat) (pORF) |
ORF071443 |
ABM |
1.0 ug DNA |
EUR 506 |
Xylene Cyanol FF |
20-abx082405 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Xylene Cyanol FF |
20-abx082546 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Rhod-FF, AM |
21077 |
AAT Bioquest |
1 mg |
EUR 306 |
- R-phrase: R20, R21, R22
- H-Phrase: H303, H313, H333
- Symbol for dangerous compounds: Xn
- UNSPEC Code: 12352200
|
Rhod-FF, AM |
21078 |
AAT Bioquest |
10x50 ug |
EUR 219 |
- R-phrase: R20, R21, R22
- H-Phrase: H303, H313, H333
- Symbol for dangerous compounds: Xn
- UNSPEC Code: 12352200
|
Xylene cyanol FF |
XB0005 |
Bio Basic |
5g |
EUR 59.57 |
- Product category: Electrophoresis Related/Tracking Dyes
|
Bovine FMRFamide- related peptides, NPFF ELISA KIT |
ELI-22105b |
Lifescience Market |
96 Tests |
EUR 928 |
Mouse FMRFamide- related peptides, Npff ELISA KIT |
ELI-44133m |
Lifescience Market |
96 Tests |
EUR 865 |
Human FMRFamide- related peptides, NPFF ELISA KIT |
ELI-44623h |
Lifescience Market |
96 Tests |
EUR 824 |
ELISA kit for Rat Pro-neuropeptide Y |
EK2390 |
SAB |
96 tests |
EUR 469 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Rat Pro-neuropeptide Y in samples from serum, plasma, tissue homogenates and other biological fluids. |
Rat Npy/ Pro-neuropeptide Y ELISA Kit |
E1085Ra |
Sunlong |
1 Kit |
EUR 546 |
ELISA kit for Rat NPY (Neuropeptide Y) |
ELK2448 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- A monoclonal antibody specific to Neuropeptide Y (NPY) has been pre-coated onto a microplate. A competitive inhibition reaction is launched between biotin labeled Neuropeptide Y (NPY) and unlabeled Neuropeptide Y (NPY) (Standards or samples) with the
- Show more
|
Description: A competitive Inhibition ELISA kit for detection of Neuropeptide Y from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Rat NPS (Neuropeptide S) |
ELK1656 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- A monoclonal antibody specific to Neuropeptide S (NPS) has been pre-coated onto a microplate. A competitive inhibition reaction is launched between biotin labeled Neuropeptide S (NPS) and unlabeled Neuropeptide S (NPS) (Standards or samples) with the
- Show more
|
Description: A competitive Inhibition ELISA kit for detection of Neuropeptide S from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Rat neuropeptide Y(NP-Y)ELISA Kit |
GA-E0548RT-48T |
GenAsia Biotech |
48T |
EUR 317 |
Rat neuropeptide Y(NP-Y)ELISA Kit |
GA-E0548RT-96T |
GenAsia Biotech |
96T |
EUR 496 |
Rat Npy(Pro-neuropeptide Y) ELISA Kit |
ER0153 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 31.2-2000 pg/ml
- Uniprot ID: P07808
- Alias: Npy/Neuropeptide Y
|
Description: Method of detection: Coated with Antigen, Competitive ELISA;Reacts with: Rattus;Sensitivity: 18.75pg/ml |
Rat Neuropeptide S receptor (NPSR1) ELISA Kit |
abx391701-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Rat Neuropeptide W(NP-W)ELISA Kit |
CSB-E17025r-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Rat Neuropeptide W (NP-W) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Rat Neuropeptide W(NP-W)ELISA Kit |
1-CSB-E17025r |
Cusabio |
-
EUR 900.00
-
EUR 5476.00
-
EUR 2900.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Rat Neuropeptide W(NP-W) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Rat neuropeptide Y,NP-Y ELISA Kit |
CN-01908R1 |
ChemNorm |
96T |
EUR 476 |
Rat neuropeptide Y,NP-Y ELISA Kit |
CN-01908R2 |
ChemNorm |
48T |
EUR 326 |
ELISA kit for Rat NPY (Neuropeptide Y) |
E-EL-R0655 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 377 |
- Gentaur's NPY ELISA kit utilizes the Competitive-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with Rat NPY. During the reaction, Rat NPY in the sample or standard competes with a fixed amount of Rat NPY on the solid
- Show more
|
Description: A competitive ELISA kit for quantitative measurement of Rat NPY (Neuropeptide Y) in samples from Serum, Plasma, Cell supernatant |
ELISA kit for Rat Neuropeptide Y (NPY) |
KTE101000-48T |
Abbkine |
48T |
EUR 354 |
- Neuropeptide Y (NPY) is a 36 amino acid peptide neurotransmitter found in the brain and autonomic nervous system.NPY is a neuropeptide that is widely expressed in the central nervous system and influences many physiological processes, including corti
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Neuropeptide Y (NPY) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Neuropeptide Y (NPY) |
KTE101000-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2252 |
- Neuropeptide Y (NPY) is a 36 amino acid peptide neurotransmitter found in the brain and autonomic nervous system.NPY is a neuropeptide that is widely expressed in the central nervous system and influences many physiological processes, including corti
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Neuropeptide Y (NPY) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Neuropeptide Y (NPY) |
KTE101000-96T |
Abbkine |
96T |
EUR 572 |
- Neuropeptide Y (NPY) is a 36 amino acid peptide neurotransmitter found in the brain and autonomic nervous system.NPY is a neuropeptide that is widely expressed in the central nervous system and influences many physiological processes, including corti
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Neuropeptide Y (NPY) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Npsr1 ELISA Kit| Rat Neuropeptide S receptor ELISA Kit |
EF019061 |
Lifescience Market |
96 Tests |
EUR 689 |
Npy ELISA Kit| Rat Pro-neuropeptide Y ELISA Kit |
EF017089 |
Lifescience Market |
96 Tests |
EUR 689 |
NPFF cloning plasmid |
CSB-CL015981HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 351
- Sequence: ATGGTTCCGCAGCCTCCTACCACTTGCCCCTGGAAGCCAGTCCCTTCCCCTTGTGACTTACGTGTCCAGGGTATTTGCCCATCTTCCTTCCCTGATACCCCCTTGGCACAGGAGGAAGACAGCGAACCCCTCCCACCACAGGATGCCCAGACCTCTGGGTCACTGTTGCACTACCT
- Show more
|
Description: A cloning plasmid for the NPFF gene. |
NPFF Rabbit pAb |
A7020-100ul |
Abclonal |
100 ul |
EUR 308 |
NPFF Rabbit pAb |
A7020-200ul |
Abclonal |
200 ul |
EUR 459 |
NPFF Rabbit pAb |
A7020-20ul |
Abclonal |
20 ul |
EUR 183 |
NPFF Rabbit pAb |
A7020-50ul |
Abclonal |
50 ul |
EUR 223 |
NPFF Polyclonal Antibody |
30794-100ul |
SAB |
100ul |
EUR 252 |
NPFF Polyclonal Antibody |
30794-50ul |
SAB |
50ul |
EUR 187 |
Anti-NPFF antibody |
STJ29100 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the FMRFamide related peptide (FARP) family of neuropeptides. The encoded preproprotein is proteolytically processed to generate multiple amidated peptides. These peptides may play a role in the regulation of heart rate and blood pressure and the modulation of morphine-induced antinociception. Patients with hypertension exhibit decreased expression of the encoded protein. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. |
Custom production of antibodies in 5 Rats using customer supplied antigen (std 63 days protocol) |
RAT-5 |
Alpha Diagnostics |
1 |
EUR 1138 |
Neuropeptide S (rat) |
H-6164.0500 |
Bachem |
0.5mg |
EUR 261 |
Description: Sum Formula: C95H160N34O27; CAS# [412938-75-1] net |
Neuropeptide S (rat) |
H-6164.1000 |
Bachem |
1.0mg |
EUR 418 |
Description: Sum Formula: C95H160N34O27; CAS# [412938-75-1] net |
Mouse Neuropeptide A ELISA kit |
E03N0033-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Neuropeptide A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Neuropeptide A ELISA kit |
E03N0033-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Neuropeptide A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Neuropeptide A ELISA kit |
E03N0033-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Neuropeptide A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Neuropeptide A ELISA kit |
E01N0033-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Neuropeptide A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Neuropeptide A ELISA kit |
E01N0033-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Neuropeptide A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Neuropeptide A ELISA kit |
E01N0033-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Neuropeptide A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Neuropeptide A ELISA kit |
E04N0033-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Neuropeptide A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Neuropeptide A ELISA kit |
E04N0033-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Neuropeptide A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Neuropeptide A ELISA kit |
E04N0033-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Neuropeptide A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Neuropeptide A ELISA kit |
E08N0033-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Neuropeptide A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Neuropeptide A ELISA kit |
E08N0033-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Neuropeptide A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Neuropeptide A ELISA kit |
E08N0033-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Neuropeptide A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Neuropeptide A ELISA kit |
E09N0033-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Neuropeptide A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Neuropeptide A ELISA kit |
E09N0033-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Neuropeptide A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Neuropeptide A ELISA kit |
E09N0033-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Neuropeptide A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Neuropeptide A ELISA kit |
E07N0033-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Neuropeptide A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Neuropeptide A ELISA kit |
E07N0033-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Neuropeptide A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Neuropeptide A ELISA kit |
E07N0033-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Neuropeptide A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Neuropeptide A ELISA kit |
E06N0033-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Neuropeptide A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Neuropeptide A ELISA kit |
E06N0033-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Neuropeptide A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Neuropeptide A ELISA kit |
E06N0033-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Neuropeptide A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat NPFF(Neuropeptide FF) ELISA Kit