Rat NPFF(Neuropeptide FF) ELISA Kit

Rat NPFF(Neuropeptide FF) ELISA Kit

To Order Contact us: [email protected]

Mouse Neuropeptide FF (NPFF) ELISA Kit
DLR-NPFF-Mu-48T 48T
EUR 527
  • Should the Mouse Neuropeptide FF (NPFF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse Neuropeptide FF (NPFF) in samples from urine, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Neuropeptide FF (NPFF) ELISA Kit
DLR-NPFF-Mu-96T 96T
EUR 688
  • Should the Mouse Neuropeptide FF (NPFF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse Neuropeptide FF (NPFF) in samples from urine, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Neuropeptide FF (NPFF) ELISA Kit
RD-NPFF-Hu-48Tests 48 Tests
EUR 521

Human Neuropeptide FF (NPFF) ELISA Kit
RD-NPFF-Hu-96Tests 96 Tests
EUR 723

Mouse Neuropeptide FF (NPFF) ELISA Kit
RD-NPFF-Mu-48Tests 48 Tests
EUR 533

Mouse Neuropeptide FF (NPFF) ELISA Kit
RD-NPFF-Mu-96Tests 96 Tests
EUR 740

Human Neuropeptide FF (NPFF) ELISA Kit
RDR-NPFF-Hu-48Tests 48 Tests
EUR 544

Human Neuropeptide FF (NPFF) ELISA Kit
RDR-NPFF-Hu-96Tests 96 Tests
EUR 756

Mouse Neuropeptide FF (NPFF) ELISA Kit
RDR-NPFF-Mu-48Tests 48 Tests
EUR 557

Mouse Neuropeptide FF (NPFF) ELISA Kit
RDR-NPFF-Mu-96Tests 96 Tests
EUR 774

Rat Neuropeptide FF (NPFF) ELISA Kit
CEG003Ra-10x96wellstestplate 10x96-wells test plate
EUR 5124.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Neuropeptide FF (NPFF) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Neuropeptide FF (NPFF) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Neuropeptide FF (NPFF) ELISA Kit
CEG003Ra-1x48wellstestplate 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Neuropeptide FF (NPFF) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Neuropeptide FF (NPFF) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Neuropeptide FF (NPFF) ELISA Kit
CEG003Ra-1x96wellstestplate 1x96-wells test plate
EUR 685.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Neuropeptide FF (NPFF) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Neuropeptide FF (NPFF) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Neuropeptide FF (NPFF) ELISA Kit
CEG003Ra-5x96wellstestplate 5x96-wells test plate
EUR 2783.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Neuropeptide FF (NPFF) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Neuropeptide FF (NPFF) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Neuropeptide FF (NPFF) ELISA Kit
4-CEG003Ra
  • EUR 5175.00
  • EUR 2734.00
  • EUR 686.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Neuropeptide FF elisa. Alternative names of the recognized antigen: FMRFAL
  • Neuropeptide FF-Amide Peptide Precursor
  • Pro-FMRFamide-related neuropeptide FF
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Rat Neuropeptide FF (NPFF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Neuropeptide FF (NPFF) ELISA Kit
20-abx258952
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Neuropeptide FF (NPFF) Antibody
20-abx132224
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Neuropeptide FF (NPFF) Antibody
abx032457-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Neuropeptide FF (NPFF) Antibody
abx032457-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Neuropeptide FF (NPFF) Antibody
20-abx006415
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Neuropeptide FF (NPFF) Antibody
20-abx173787
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Neuropeptide FF (NPFF) Antibody
20-abx177768
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Neuropeptide FF (NPFF) Antibody
20-abx177769
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Neuropeptide FF (NPFF) Antibody
20-abx177770
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Neuropeptide FF (NPFF) Antibody
20-abx320780
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Recombinant Neuropeptide FF (NPFF)
4-RPG003Mu01
  • EUR 485.28
  • EUR 233.00
  • EUR 1544.80
  • EUR 581.60
  • EUR 1063.20
  • EUR 388.00
  • EUR 3712.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9WVA8
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 41.3kDa
  • Isoelectric Point: 9.5
Description: Recombinant Mouse Neuropeptide FF expressed in: E.coli

Rat Neuropeptide FF (NPFF) CLIA Kit
20-abx490636
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Rat NPFF (Neuropeptide FF)
ELK7704 1 plate of 96 wells
EUR 432
  • A monoclonal antibody specific to Neuropeptide FF (NPFF) has been pre-coated onto a microplate. A competitive inhibition reaction is launched between biotin labeled Neuropeptide FF (NPFF) and unlabeled Neuropeptide FF (NPFF) (Standards or samples) wi
  • Show more
Description: A competitive Inhibition ELISA kit for detection of Neuropeptide FF from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Neuropeptide FF (NPFF) ELISA Kit
CEG003Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neuropeptide FF (NPFF) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Neuropeptide FF (NPFF) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Neuropeptide FF (NPFF) ELISA Kit
CEG003Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neuropeptide FF (NPFF) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Neuropeptide FF (NPFF) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Neuropeptide FF (NPFF) ELISA Kit
CEG003Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neuropeptide FF (NPFF) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Neuropeptide FF (NPFF) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Neuropeptide FF (NPFF) ELISA Kit
CEG003Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neuropeptide FF (NPFF) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Neuropeptide FF (NPFF) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Neuropeptide FF (NPFF) ELISA Kit
4-CEG003Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Neuropeptide FF elisa. Alternative names of the recognized antigen: FMRFAL
  • Neuropeptide FF-Amide Peptide Precursor
  • Pro-FMRFamide-related neuropeptide FF
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Neuropeptide FF (NPFF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Neuropeptide FF (NPFF) ELISA Kit
CEG003Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Neuropeptide FF (NPFF) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Mouse Neuropeptide FF (NPFF) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Mouse Neuropeptide FF (NPFF) ELISA Kit
CEG003Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Neuropeptide FF (NPFF) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Mouse Neuropeptide FF (NPFF) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Mouse Neuropeptide FF (NPFF) ELISA Kit
CEG003Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Neuropeptide FF (NPFF) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Mouse Neuropeptide FF (NPFF) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Mouse Neuropeptide FF (NPFF) ELISA Kit
CEG003Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Neuropeptide FF (NPFF) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Mouse Neuropeptide FF (NPFF) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Mouse Neuropeptide FF (NPFF) ELISA Kit
4-CEG003Mu
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Neuropeptide FF elisa. Alternative names of the recognized antigen: FMRFAL
  • Neuropeptide FF-Amide Peptide Precursor
  • Pro-FMRFamide-related neuropeptide FF
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Mouse Neuropeptide FF (NPFF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Neuropeptide FF (NPFF) ELISA Kit
20-abx154455
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Neuropeptide FF (NPFF) ELISA Kit
20-abx152503
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Neuropeptide FF ELISA Kit (NPFF)
RK01954 96 Tests
EUR 521

Mouse Neuropeptide FF ELISA Kit (NPFF)
RK03071 96 Tests
EUR 521

Rat Neuropeptide FF (NPFF) Peptide (OVA)
20-abx651249
  • EUR 272.00
  • EUR 189.00
  • EUR 606.00
  • EUR 300.00
  • EUR 230.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Neuropeptide FF (NPFF) Polyclonal Antibody (Rat)
4-PAG003Ra08
  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CPG003Ra21-OVA Conjugated Neuropeptide FF (NPFF)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Neuropeptide FF (NPFF)

Human Neuropeptide FF (NPFF) Protein
20-abx654526
  • EUR 662.00
  • EUR 272.00
  • EUR 2026.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Mouse Neuropeptide FF (NPFF) Peptide
20-abx652235
  • EUR 676.00
  • EUR 286.00
  • EUR 2082.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

OVA Conjugated Neuropeptide FF (NPFF)
4-CPG003Hu21
  • EUR 187.81
  • EUR 153.00
  • EUR 429.28
  • EUR 209.76
  • EUR 319.52
  • EUR 188.00
  • EUR 923.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O15130
  • Buffer composition: PBS, pH 7.4.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): Inquire
  • Isoelectric Point: Inquire
Description: Recombinant Human Neuropeptide FF expressed in: chemical synthesis

OVA Conjugated Neuropeptide FF (NPFF)
4-CPG003Mu21
  • EUR 187.81
  • EUR 153.00
  • EUR 429.28
  • EUR 209.76
  • EUR 319.52
  • EUR 188.00
  • EUR 923.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9WVA8
  • Buffer composition: PBS, pH 7.4.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): Inquire
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Neuropeptide FF expressed in: chemical synthesis

OVA Conjugated Neuropeptide FF (NPFF)
4-CPG003Ra21
  • EUR 187.81
  • EUR 153.00
  • EUR 429.28
  • EUR 209.76
  • EUR 319.52
  • EUR 188.00
  • EUR 923.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9WVA9
  • Buffer composition: PBS, pH 7.4.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): Inquire
  • Isoelectric Point: Inquire
Description: Recombinant Rat Neuropeptide FF expressed in: chemical synthesis

Human Neuropeptide FF (NPFF) CLIA Kit
20-abx490520
  • EUR 7911.00
  • EUR 4215.00
  • EUR 973.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Neuropeptide FF (NPFF) CLIA Kit
20-abx490521
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human NPFF (Neuropeptide FF)
ELK3724 1 plate of 96 wells
EUR 432
  • A monoclonal antibody specific to Neuropeptide FF (NPFF) has been pre-coated onto a microplate. A competitive inhibition reaction is launched between biotin labeled Neuropeptide FF (NPFF) and unlabeled Neuropeptide FF (NPFF) (Standards or samples) wi
  • Show more
Description: A competitive Inhibition ELISA kit for detection of Neuropeptide FF from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse NPFF (Neuropeptide FF)
ELK6090 1 plate of 96 wells
EUR 432
  • A monoclonal antibody specific to Neuropeptide FF (NPFF) has been pre-coated onto a microplate. A competitive inhibition reaction is launched between biotin labeled Neuropeptide FF (NPFF) and unlabeled Neuropeptide FF (NPFF) (Standards or samples) wi
  • Show more
Description: A competitive Inhibition ELISA kit for detection of Neuropeptide FF from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Neuropeptide FF (NPFF) Polyclonal Antibody (Rat), APC
4-PAG003Ra08-APC
  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CPG003Ra21-OVA Conjugated Neuropeptide FF (NPFF)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Neuropeptide FF (NPFF). This antibody is labeled with APC.

Neuropeptide FF (NPFF) Polyclonal Antibody (Rat), Biotinylated
4-PAG003Ra08-Biotin
  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CPG003Ra21-OVA Conjugated Neuropeptide FF (NPFF)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Neuropeptide FF (NPFF). This antibody is labeled with Biotin.

Neuropeptide FF (NPFF) Polyclonal Antibody (Rat), Cy3
4-PAG003Ra08-Cy3
  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CPG003Ra21-OVA Conjugated Neuropeptide FF (NPFF)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Neuropeptide FF (NPFF). This antibody is labeled with Cy3.

Neuropeptide FF (NPFF) Polyclonal Antibody (Rat), FITC
4-PAG003Ra08-FITC
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CPG003Ra21-OVA Conjugated Neuropeptide FF (NPFF)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Neuropeptide FF (NPFF). This antibody is labeled with FITC.

Neuropeptide FF (NPFF) Polyclonal Antibody (Rat), HRP
4-PAG003Ra08-HRP
  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CPG003Ra21-OVA Conjugated Neuropeptide FF (NPFF)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Neuropeptide FF (NPFF). This antibody is labeled with HRP.

Neuropeptide FF (NPFF) Polyclonal Antibody (Rat), PE
4-PAG003Ra08-PE
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CPG003Ra21-OVA Conjugated Neuropeptide FF (NPFF)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Neuropeptide FF (NPFF). This antibody is labeled with PE.

Human Neuropeptide FF (NPFF) Peptide (OVA)
20-abx651247
  • EUR 272.00
  • EUR 189.00
  • EUR 606.00
  • EUR 300.00
  • EUR 230.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Neuropeptide FF (NPFF) Peptide (OVA)
20-abx651248
  • EUR 272.00
  • EUR 189.00
  • EUR 606.00
  • EUR 300.00
  • EUR 230.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Npff ELISA Kit| Rat Pro-FMRFamide-related neuropeptide FF ELISA
EF019060 96 Tests
EUR 689

Neuropeptide FF (NPFF) Polyclonal Antibody (Rat), APC-Cy7
4-PAG003Ra08-APC-Cy7
  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CPG003Ra21-OVA Conjugated Neuropeptide FF (NPFF)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Neuropeptide FF (NPFF). This antibody is labeled with APC-Cy7.

Npff ELISA Kit| Mouse Pro-FMRFamide-related neuropeptide FF ELI
EF015671 96 Tests
EUR 689

NPFF ELISA Kit| Bovine Pro-FMRFamide-related neuropeptide FF EL
EF011662 96 Tests
EUR 689

Neuropeptide FF
B5386-1 1 mg
EUR 224

Neuropeptide FF
H-5655.0001 1.0mg
EUR 176
Description: Sum Formula: C54H76N14O10; CAS# [99566-27-5]

Neuropeptide FF
H-5655.0005 5.0mg
EUR 611
Description: Sum Formula: C54H76N14O10; CAS# [99566-27-5]

Rat Neuropeptide FF receptor 2 (NPFFR2) ELISA Kit
abx515900-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Rat Npffr2/ Neuropeptide FF receptor 2 ELISA Kit
E0684Ra 1 Kit
EUR 646

Npff/ Rat Npff ELISA Kit
ELI-13702r 96 Tests
EUR 886

Npffr2 ELISA Kit| Rat Neuropeptide FF receptor 2 ELISA Kit
EF019059 96 Tests
EUR 689

Mouse Neuropeptide FF receptor 2 (NPFFR2) ELISA Kit
abx515899-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

ELISA kit for Human Neuropeptide FF receptor 2
EK3014 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Neuropeptide FF receptor 2 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human NPFFR2/ Neuropeptide FF receptor 2 ELISA Kit
E1773Hu 1 Kit
EUR 605

Human NPFFR2(Neuropeptide FF receptor 2) ELISA Kit
EH1402 96T
EUR 567.6
  • Detection range: 0.625-40 ng/ml
  • Uniprot ID: Q9Y5X5
  • Alias: NPFFR2/Neuropeptide FF receptor 2/Neuropeptide G-protein coupled receptor/G-protein coupled receptor 74/G-protein coupled receptor HLWAR77
Description: Method of detection: Coated with Antigen, Competitive ELISA;Reacts with: Homo sapiens;Sensitivity: 0.375 ng/ml

Human Neuropeptide FF receptor 1, NPFFR1 ELISA KIT
ELI-13105h 96 Tests
EUR 824

Mouse Neuropeptide FF receptor 2, Npffr2 ELISA KIT
ELI-13106m 96 Tests
EUR 865

Human Neuropeptide FF receptor 2, NPFFR2 ELISA KIT
ELI-22247h 96 Tests
EUR 824

Human Neuropeptide FF receptor 2 (NPFFR2) ELISA Kit
abx250677-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Npffr2 ELISA Kit| Mouse Neuropeptide FF receptor 2 ELISA Kit
EF015670 96 Tests
EUR 689

Neuropeptide FF Receptor 2 (NPFFR2) Antibody
abx027655-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Neuropeptide FF Receptor 2 (NPFFR2) Antibody
abx027655-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Neuropeptide FF Receptor 1 (NPFFR1) Antibody
abx027869-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Neuropeptide FF Receptor 1 (NPFFR1) Antibody
abx027869-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Neuropeptide FF Receptor 1 (NPFFR1) Antibody
abx433057-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Neuropeptide FF Receptor 2 (NPFFR2) Antibody
abx235815-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Human Neuropeptide FF receptor 2 (NPFFR2)
1-CSB-YP015983HU
  • EUR 430.00
  • EUR 234.00
  • EUR 1508.00
  • EUR 642.00
  • EUR 1009.00
  • EUR 291.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 50.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Neuropeptide FF receptor 2(NPFFR2) expressed in Yeast

Recombinant human Neuropeptide FF receptor 2
P1899 100ug Ask for price
  • Uniprot ID: Q9Y5X5
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Neuropeptide FF receptor 2

Neuropeptide FF Morphine Modulating Neuropeptide F-8-F-NH2
20-abx266130
  • EUR 411.00
  • EUR 662.00
  • EUR 314.00
  • 10 mg
  • 25 mg
  • 5 mg
  • Shipped within 5-10 working days.

Neuropeptide FF Morphine Modulating Neuropeptide F-8-F-NH2
5-01611 4 x 5mg Ask for price

(D-Tyr1,N-Me-Phe3)-Neuropeptide FF
H-4752.0001 1.0mg
EUR 466
Description: Sum Formula: C55H78N14O11; CAS# [145274-93-7] net

(D-Tyr1,N-Me-Phe3)-Neuropeptide FF
H-4752.0005 5.0mg
EUR 1772
Description: Sum Formula: C55H78N14O11; CAS# [145274-93-7] net

NPFF ELISA KIT|Human
EF005344 96 Tests
EUR 689

Recombinant Human Neuropeptide FF receptor 2 Protein, His, Yeast-100ug
QP9310-ye-100ug 100ug
EUR 480

Recombinant Human Neuropeptide FF receptor 2 Protein, His, Yeast-10ug
QP9310-ye-10ug 10ug
EUR 236

Recombinant Human Neuropeptide FF receptor 2 Protein, His, Yeast-1mg
QP9310-ye-1mg 1mg
EUR 1885

Recombinant Human Neuropeptide FF receptor 2 Protein, His, Yeast-200ug
QP9310-ye-200ug 200ug
EUR 744

Recombinant Human Neuropeptide FF receptor 2 Protein, His, Yeast-500ug
QP9310-ye-500ug 500ug
EUR 1206

Recombinant Human Neuropeptide FF receptor 2 Protein, His, Yeast-50ug
QP9310-ye-50ug 50ug
EUR 299

Rat Neuropeptide A ELISA kit
E02N0033-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Neuropeptide A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Neuropeptide A ELISA kit
E02N0033-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Neuropeptide A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Neuropeptide A ELISA kit
E02N0033-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Neuropeptide A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat NPFF shRNA Plasmid
20-abx986017
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NPFF Recombinant Protein (Rat)
RP214325 100 ug Ask for price

FF-10101
HY-109584 50mg
EUR 681

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202

NPFF siRNA
20-abx903617
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NPFF siRNA
20-abx926232
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NPFF siRNA
20-abx926233
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NPFF Antibody
1-CSB-PA015981ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against NPFF. Recognizes NPFF from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

Rat Neuropeptide Y (NPY) ELISA Kit
CEA879Ra-10x96wellstestplate 10x96-wells test plate
EUR 4626.78
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Neuropeptide Y (NPY) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Neuropeptide Y (NPY) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Neuropeptide Y (NPY) ELISA Kit
CEA879Ra-1x48wellstestplate 1x48-wells test plate
EUR 468.68
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Neuropeptide Y (NPY) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Neuropeptide Y (NPY) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Neuropeptide Y (NPY) ELISA Kit
CEA879Ra-1x96wellstestplate 1x96-wells test plate
EUR 626.68
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Neuropeptide Y (NPY) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Neuropeptide Y (NPY) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Neuropeptide Y (NPY) ELISA Kit
CEA879Ra-5x96wellstestplate 5x96-wells test plate
EUR 2520.06
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Neuropeptide Y (NPY) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Neuropeptide Y (NPY) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Neuropeptide Y (NPY) ELISA Kit
4-CEA879Ra
  • EUR 4677.00
  • EUR 2471.00
  • EUR 627.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Neuropeptide Y elisa. Alternative names of the recognized antigen: NP-Y
  • PYY4
  • CPON
  • Pro-neuropeptide Y
  • Neuropeptide tyrosine
  • C-flanking peptide of NPY
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Rat Neuropeptide Y (NPY) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Neuropeptide S (NPS) ELISA Kit
CEA796Ra-10x96wellstestplate 10x96-wells test plate
EUR 4626.78
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Neuropeptide S (NPS) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Neuropeptide S (NPS) in serum, plasma and other biological fluids.

Rat Neuropeptide S (NPS) ELISA Kit
CEA796Ra-1x48wellstestplate 1x48-wells test plate
EUR 468.68
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Neuropeptide S (NPS) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Neuropeptide S (NPS) in serum, plasma and other biological fluids.

Rat Neuropeptide S (NPS) ELISA Kit
CEA796Ra-1x96wellstestplate 1x96-wells test plate
EUR 626.68
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Neuropeptide S (NPS) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Neuropeptide S (NPS) in serum, plasma and other biological fluids.

Rat Neuropeptide S (NPS) ELISA Kit
CEA796Ra-5x96wellstestplate 5x96-wells test plate
EUR 2520.06
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Neuropeptide S (NPS) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Neuropeptide S (NPS) in serum, plasma and other biological fluids.

Rat Neuropeptide S (NPS) ELISA Kit
4-CEA796Ra
  • EUR 4677.00
  • EUR 2471.00
  • EUR 627.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Neuropeptide S elisa. Alternative names of the recognized antigen: NP-S
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Rat Neuropeptide S (NPS) in samples from Serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Neuropeptide S (NPS) ELISA Kit
abx574146-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Neuropeptide Y (NPY) ELISA Kit
abx575140-96tests 96 tests
EUR 746
  • Shipped within 5-12 working days.

Rat Nps/ Neuropeptide S ELISA Kit
E0690Ra 1 Kit
EUR 646

Rat Neuropeptide W(NPW) ELISA kit
E02N0558-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Neuropeptide W(NPW) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Neuropeptide W(NPW) ELISA kit
E02N0558-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Neuropeptide W(NPW) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Neuropeptide W(NPW) ELISA kit
E02N0558-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Neuropeptide W(NPW) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Rat Neuropeptide S
EK4731 96 tests
EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of Rat Neuropeptide S in samples from serum, plasma, tissue homogenates and other biological fluids.

Rat Nps(Neuropeptide S) ELISA Kit
ER0673 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P0C0P7
  • Alias: Nps
Description: Method of detection: Coated with Antigen, Competitive ELISA;Reacts with: Rattus;Sensitivity: 0.094 ng/ml

Rat Neuropeptide S (NPS) ELISA Kit
20-abx155884
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Neuropeptide Y (NPY) ELISA Kit
20-abx155885
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Neuropeptide Y (NPY) ELISA Kit
abx256138-96tests 96 tests
EUR 746
  • Shipped within 5-12 working days.

Rat Neuropeptide S (NPS) ELISA Kit
abx256648-96tests 96 tests
EUR 746
  • Shipped within 5-12 working days.

Rat Neuropeptide S (NPS) ELISA Kit
DLR-NPS-Ra-48T 48T
EUR 508
  • Should the Rat Neuropeptide S (NPS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat Neuropeptide S (NPS) in samples from serum, plasma or other biological fluids.

Rat Neuropeptide S (NPS) ELISA Kit
DLR-NPS-Ra-96T 96T
EUR 661
  • Should the Rat Neuropeptide S (NPS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat Neuropeptide S (NPS) in samples from serum, plasma or other biological fluids.

Rat Neuropeptide Y (NPY) ELISA Kit
DLR-NPY-Ra-48T 48T
EUR 508
  • Should the Rat Neuropeptide Y (NPY) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat Neuropeptide Y (NPY) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Neuropeptide Y (NPY) ELISA Kit
DLR-NPY-Ra-96T 96T
EUR 661
  • Should the Rat Neuropeptide Y (NPY) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat Neuropeptide Y (NPY) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Neuropeptide S(NPS) ELISA kit
CSB-EL016026RA-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Neuropeptide S (NPS) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Rat Neuropeptide S(NPS) ELISA kit
1-CSB-EL016026RA
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Neuropeptide S(NPS) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Rat neuropeptide Y (NPY) ELISA kit
CSB-E13431r-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat neuropeptide Y (NPY) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Rat neuropeptide Y (NPY) ELISA kit
1-CSB-E13431r
  • EUR 703.00
  • EUR 4843.00
  • EUR 2570.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat neuropeptide Y (NPY) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Rat Neuropeptide Y ELISA Kit (NPY)
RK03847 96 Tests
EUR 521

Rat Neuropeptide S (NPS) ELISA Kit
RD-NPS-Ra-48Tests 48 Tests
EUR 511

Rat Neuropeptide S (NPS) ELISA Kit
RD-NPS-Ra-96Tests 96 Tests
EUR 709

Rat Neuropeptide Y (NPY) ELISA Kit
RD-NPY-Ra-48Tests 48 Tests
EUR 511

Rat Neuropeptide Y (NPY) ELISA Kit
RD-NPY-Ra-96Tests 96 Tests
EUR 709

Rat Neuropeptide S (NPS) ELISA Kit
RDR-NPS-Ra-48Tests 48 Tests
EUR 534

Rat Neuropeptide S (NPS) ELISA Kit
RDR-NPS-Ra-96Tests 96 Tests
EUR 742

Rat Neuropeptide Y (NPY) ELISA Kit
RDR-NPY-Ra-48Tests 48 Tests
EUR 534

Rat Neuropeptide Y (NPY) ELISA Kit
RDR-NPY-Ra-96Tests 96 Tests
EUR 742

Nps ELISA Kit| Rat Neuropeptide S ELISA Kit
EF017488 96 Tests
EUR 689

Npff ORF Vector (Rat) (pORF)
ORF071443 1.0 ug DNA
EUR 506

FF-10101 (succinate)
HY-109584A 10mg
EUR 326

Xylene Cyanol FF
20-abx082405
  • EUR 189.00
  • EUR 230.00
  • 1 g
  • 5 g
  • Shipped within 5-10 working days.

Xylene Cyanol FF
20-abx082546
  • EUR 175.00
  • EUR 217.00
  • 1 g
  • 5 g
  • Shipped within 5-10 working days.

Rhod-FF, AM
21077 1 mg
EUR 306
  • R-phrase: R20, R21, R22
  • H-Phrase: H303, H313, H333
  • Symbol for dangerous compounds: Xn
  • UNSPEC Code: 12352200

Rhod-FF, AM
21078 10x50 ug
EUR 219
  • R-phrase: R20, R21, R22
  • H-Phrase: H303, H313, H333
  • Symbol for dangerous compounds: Xn
  • UNSPEC Code: 12352200

Xylene cyanol FF
XB0005 5g
EUR 59.57
  • Product category: Electrophoresis Related/Tracking Dyes

Bovine FMRFamide- related peptides, NPFF ELISA KIT
ELI-22105b 96 Tests
EUR 928

Mouse FMRFamide- related peptides, Npff ELISA KIT
ELI-44133m 96 Tests
EUR 865

Human FMRFamide- related peptides, NPFF ELISA KIT
ELI-44623h 96 Tests
EUR 824

ELISA kit for Rat Pro-neuropeptide Y
EK2390 96 tests
EUR 469
Description: Enzyme-linked immunosorbent assay kit for quantification of Rat Pro-neuropeptide Y in samples from serum, plasma, tissue homogenates and other biological fluids.

Rat Npy/ Pro-neuropeptide Y ELISA Kit
E1085Ra 1 Kit
EUR 546

Rat Pro- neuropeptide Y, Npy ELISA KIT
ELI-02959r 96 Tests
EUR 886

ELISA kit for Rat NPY (Neuropeptide Y)
ELK2448 1 plate of 96 wells
EUR 432
  • A monoclonal antibody specific to Neuropeptide Y (NPY) has been pre-coated onto a microplate. A competitive inhibition reaction is launched between biotin labeled Neuropeptide Y (NPY) and unlabeled Neuropeptide Y (NPY) (Standards or samples) with the
  • Show more
Description: A competitive Inhibition ELISA kit for detection of Neuropeptide Y from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Rat NPS (Neuropeptide S)
ELK1656 1 plate of 96 wells
EUR 432
  • A monoclonal antibody specific to Neuropeptide S (NPS) has been pre-coated onto a microplate. A competitive inhibition reaction is launched between biotin labeled Neuropeptide S (NPS) and unlabeled Neuropeptide S (NPS) (Standards or samples) with the
  • Show more
Description: A competitive Inhibition ELISA kit for detection of Neuropeptide S from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Rat neuropeptide Y(NP-Y)ELISA Kit
GA-E0548RT-48T 48T
EUR 317

Rat neuropeptide Y(NP-Y)ELISA Kit
GA-E0548RT-96T 96T
EUR 496

Rat Npy(Pro-neuropeptide Y) ELISA Kit
ER0153 96T
EUR 567.6
  • Detection range: 31.2-2000 pg/ml
  • Uniprot ID: P07808
  • Alias: Npy/Neuropeptide Y
Description: Method of detection: Coated with Antigen, Competitive ELISA;Reacts with: Rattus;Sensitivity: 18.75pg/ml

Rat Neuropeptide S receptor (NPSR1) ELISA Kit
abx391701-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat Neuropeptide W(NP-W)ELISA Kit
CSB-E17025r-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Neuropeptide W (NP-W) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Rat Neuropeptide W(NP-W)ELISA Kit
1-CSB-E17025r
  • EUR 900.00
  • EUR 5476.00
  • EUR 2900.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Neuropeptide W(NP-W) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Rat neuropeptide Y,NP-Y ELISA Kit
CN-01908R1 96T
EUR 476

Rat neuropeptide Y,NP-Y ELISA Kit
CN-01908R2 48T
EUR 326

ELISA kit for Rat NPY (Neuropeptide Y)
E-EL-R0655 1 plate of 96 wells
EUR 377
  • Gentaur's NPY ELISA kit utilizes the Competitive-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with Rat NPY. During the reaction, Rat NPY in the sample or standard competes with a fixed amount of Rat NPY on the solid
  • Show more
Description: A competitive ELISA kit for quantitative measurement of Rat NPY (Neuropeptide Y) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Rat Neuropeptide Y (NPY)
KTE101000-48T 48T
EUR 354
  • Neuropeptide Y (NPY) is a 36 amino acid peptide neurotransmitter found in the brain and autonomic nervous system.NPY is a neuropeptide that is widely expressed in the central nervous system and influences many physiological processes, including corti
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Neuropeptide Y (NPY) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Neuropeptide Y (NPY)
KTE101000-5platesof96wells 5 plates of 96 wells
EUR 2252
  • Neuropeptide Y (NPY) is a 36 amino acid peptide neurotransmitter found in the brain and autonomic nervous system.NPY is a neuropeptide that is widely expressed in the central nervous system and influences many physiological processes, including corti
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Neuropeptide Y (NPY) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Neuropeptide Y (NPY)
KTE101000-96T 96T
EUR 572
  • Neuropeptide Y (NPY) is a 36 amino acid peptide neurotransmitter found in the brain and autonomic nervous system.NPY is a neuropeptide that is widely expressed in the central nervous system and influences many physiological processes, including corti
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Neuropeptide Y (NPY) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Rat neuropeptide Y(NP-Y)ELISA Kit
QY-E11104 96T
EUR 361

Npsr1 ELISA Kit| Rat Neuropeptide S receptor ELISA Kit
EF019061 96 Tests
EUR 689

Npy ELISA Kit| Rat Pro-neuropeptide Y ELISA Kit
EF017089 96 Tests
EUR 689

NPFF cloning plasmid
CSB-CL015981HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 351
  • Sequence: ATGGTTCCGCAGCCTCCTACCACTTGCCCCTGGAAGCCAGTCCCTTCCCCTTGTGACTTACGTGTCCAGGGTATTTGCCCATCTTCCTTCCCTGATACCCCCTTGGCACAGGAGGAAGACAGCGAACCCCTCCCACCACAGGATGCCCAGACCTCTGGGTCACTGTTGCACTACCT
  • Show more
Description: A cloning plasmid for the NPFF gene.

NPFF Rabbit pAb
A7020-100ul 100 ul
EUR 308

NPFF Rabbit pAb
A7020-200ul 200 ul
EUR 459

NPFF Rabbit pAb
A7020-20ul 20 ul
EUR 183

NPFF Rabbit pAb
A7020-50ul 50 ul
EUR 223

NPFF Polyclonal Antibody
30794-100ul 100ul
EUR 252

NPFF Polyclonal Antibody
30794-50ul 50ul
EUR 187

Anti-NPFF antibody
STJ29100 100 µl
EUR 277
Description: This gene encodes a member of the FMRFamide related peptide (FARP) family of neuropeptides. The encoded preproprotein is proteolytically processed to generate multiple amidated peptides. These peptides may play a role in the regulation of heart rate and blood pressure and the modulation of morphine-induced antinociception. Patients with hypertension exhibit decreased expression of the encoded protein. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed.

Custom production of antibodies in 5 Rats using customer supplied antigen (std 63 days protocol)
RAT-5 1
EUR 1138

Neuropeptide S (rat)
H-6164.0500 0.5mg
EUR 261
Description: Sum Formula: C95H160N34O27; CAS# [412938-75-1] net

Neuropeptide S (rat)
H-6164.1000 1.0mg
EUR 418
Description: Sum Formula: C95H160N34O27; CAS# [412938-75-1] net

Mouse Neuropeptide A ELISA kit
E03N0033-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Neuropeptide A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Neuropeptide A ELISA kit
E03N0033-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Neuropeptide A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Neuropeptide A ELISA kit
E03N0033-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Neuropeptide A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Neuropeptide A ELISA kit
E01N0033-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Neuropeptide A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Neuropeptide A ELISA kit
E01N0033-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Neuropeptide A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Neuropeptide A ELISA kit
E01N0033-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Neuropeptide A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Neuropeptide A ELISA kit
E04N0033-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Neuropeptide A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Neuropeptide A ELISA kit
E04N0033-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Neuropeptide A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Neuropeptide A ELISA kit
E04N0033-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Neuropeptide A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Bovine neuropeptide Y ELISA Kit
ELA-E0879b 96 Tests
EUR 928

Dog Neuropeptide A ELISA kit
E08N0033-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Neuropeptide A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Neuropeptide A ELISA kit
E08N0033-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Neuropeptide A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Neuropeptide A ELISA kit
E08N0033-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Neuropeptide A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Neuropeptide A ELISA kit
E09N0033-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Neuropeptide A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Neuropeptide A ELISA kit
E09N0033-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Neuropeptide A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Neuropeptide A ELISA kit
E09N0033-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Neuropeptide A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Neuropeptide A ELISA kit
E07N0033-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Neuropeptide A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Neuropeptide A ELISA kit
E07N0033-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Neuropeptide A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Neuropeptide A ELISA kit
E07N0033-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Neuropeptide A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Neuropeptide A ELISA kit
E06N0033-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Neuropeptide A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Neuropeptide A ELISA kit
E06N0033-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Neuropeptide A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Neuropeptide A ELISA kit
E06N0033-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Neuropeptide A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat NPFF(Neuropeptide FF) ELISA Kit